ID: 1157887865

View in Genome Browser
Species Human (GRCh38)
Location 18:51385660-51385682
Sequence TCTACTATTTAGAAGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157887858_1157887865 27 Left 1157887858 18:51385610-51385632 CCAGGTAGATAGAAAGCTGCATG No data
Right 1157887865 18:51385660-51385682 TCTACTATTTAGAAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157887865 Original CRISPR TCTACTATTTAGAAGCAGGT GGG Intergenic
No off target data available for this crispr