ID: 1157893205

View in Genome Browser
Species Human (GRCh38)
Location 18:51438600-51438622
Sequence CCTCATTTCCTCCACCACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157893205_1157893213 17 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893213 18:51438640-51438662 GCAGGAGAGGGCAGGAGGCCAGG No data
1157893205_1157893215 22 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893215 18:51438645-51438667 AGAGGGCAGGAGGCCAGGGATGG No data
1157893205_1157893217 28 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893217 18:51438651-51438673 CAGGAGGCCAGGGATGGTCTGGG No data
1157893205_1157893216 27 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893216 18:51438650-51438672 GCAGGAGGCCAGGGATGGTCTGG No data
1157893205_1157893212 12 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG No data
1157893205_1157893207 -5 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893207 18:51438618-51438640 TGAGGTGAGCAGAGACACAGAGG No data
1157893205_1157893214 18 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893214 18:51438641-51438663 CAGGAGAGGGCAGGAGGCCAGGG No data
1157893205_1157893210 5 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893210 18:51438628-51438650 AGAGACACAGAGGCAGGAGAGGG No data
1157893205_1157893209 4 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893209 18:51438627-51438649 CAGAGACACAGAGGCAGGAGAGG No data
1157893205_1157893208 -1 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893208 18:51438622-51438644 GTGAGCAGAGACACAGAGGCAGG No data
1157893205_1157893211 9 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893211 18:51438632-51438654 ACACAGAGGCAGGAGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157893205 Original CRISPR CCTCATTTCCTCCACCACGA AGG (reversed) Intergenic
No off target data available for this crispr