ID: 1157893212

View in Genome Browser
Species Human (GRCh38)
Location 18:51438635-51438657
Sequence CAGAGGCAGGAGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157893205_1157893212 12 Left 1157893205 18:51438600-51438622 CCTTCGTGGTGGAGGAAATGAGG No data
Right 1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157893212 Original CRISPR CAGAGGCAGGAGAGGGCAGG AGG Intergenic
No off target data available for this crispr