ID: 1157894274

View in Genome Browser
Species Human (GRCh38)
Location 18:51449095-51449117
Sequence CGTGCAGAGACTCCCCGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157894272_1157894274 1 Left 1157894272 18:51449071-51449093 CCGCAGACTTGTACCAAAGAGAT No data
Right 1157894274 18:51449095-51449117 CGTGCAGAGACTCCCCGCGCAGG No data
1157894271_1157894274 18 Left 1157894271 18:51449054-51449076 CCTCAGCAGGGCTACTGCCGCAG No data
Right 1157894274 18:51449095-51449117 CGTGCAGAGACTCCCCGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157894274 Original CRISPR CGTGCAGAGACTCCCCGCGC AGG Intergenic
No off target data available for this crispr