ID: 1157894637

View in Genome Browser
Species Human (GRCh38)
Location 18:51453987-51454009
Sequence CCCAGATACAAGTGGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157894632_1157894637 -9 Left 1157894632 18:51453973-51453995 CCTAAGTGACATATCCCAGATAC No data
Right 1157894637 18:51453987-51454009 CCCAGATACAAGTGGGGACATGG No data
1157894631_1157894637 3 Left 1157894631 18:51453961-51453983 CCTGGAATTTAACCTAAGTGACA No data
Right 1157894637 18:51453987-51454009 CCCAGATACAAGTGGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157894637 Original CRISPR CCCAGATACAAGTGGGGACA TGG Intergenic
No off target data available for this crispr