ID: 1157897100

View in Genome Browser
Species Human (GRCh38)
Location 18:51479513-51479535
Sequence CATGGTCATCTTGAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157897100_1157897106 13 Left 1157897100 18:51479513-51479535 CCTTCTACCTCAAGATGACCATG No data
Right 1157897106 18:51479549-51479571 AACCCAAGGGTCTAGGCTAAAGG No data
1157897100_1157897105 6 Left 1157897100 18:51479513-51479535 CCTTCTACCTCAAGATGACCATG No data
Right 1157897105 18:51479542-51479564 AGAAAATAACCCAAGGGTCTAGG No data
1157897100_1157897104 0 Left 1157897100 18:51479513-51479535 CCTTCTACCTCAAGATGACCATG No data
Right 1157897104 18:51479536-51479558 AAAGAAAGAAAATAACCCAAGGG No data
1157897100_1157897103 -1 Left 1157897100 18:51479513-51479535 CCTTCTACCTCAAGATGACCATG No data
Right 1157897103 18:51479535-51479557 GAAAGAAAGAAAATAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157897100 Original CRISPR CATGGTCATCTTGAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr