ID: 1157901979

View in Genome Browser
Species Human (GRCh38)
Location 18:51526716-51526738
Sequence CAGGGGCCTGCAGGTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157901979_1157901994 21 Left 1157901979 18:51526716-51526738 CCAGGACCACCTGCAGGCCCCTG No data
Right 1157901994 18:51526760-51526782 AGATAATGCAGCCAGTGGTCAGG No data
1157901979_1157901989 -4 Left 1157901979 18:51526716-51526738 CCAGGACCACCTGCAGGCCCCTG No data
Right 1157901989 18:51526735-51526757 CCTGGGGTAGAAGCAGCCCTGGG No data
1157901979_1157901990 -3 Left 1157901979 18:51526716-51526738 CCAGGACCACCTGCAGGCCCCTG No data
Right 1157901990 18:51526736-51526758 CTGGGGTAGAAGCAGCCCTGGGG No data
1157901979_1157901993 16 Left 1157901979 18:51526716-51526738 CCAGGACCACCTGCAGGCCCCTG No data
Right 1157901993 18:51526755-51526777 GGGGCAGATAATGCAGCCAGTGG No data
1157901979_1157901996 28 Left 1157901979 18:51526716-51526738 CCAGGACCACCTGCAGGCCCCTG No data
Right 1157901996 18:51526767-51526789 GCAGCCAGTGGTCAGGCAGTGGG No data
1157901979_1157901987 -5 Left 1157901979 18:51526716-51526738 CCAGGACCACCTGCAGGCCCCTG No data
Right 1157901987 18:51526734-51526756 CCCTGGGGTAGAAGCAGCCCTGG No data
1157901979_1157901995 27 Left 1157901979 18:51526716-51526738 CCAGGACCACCTGCAGGCCCCTG No data
Right 1157901995 18:51526766-51526788 TGCAGCCAGTGGTCAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157901979 Original CRISPR CAGGGGCCTGCAGGTGGTCC TGG (reversed) Intergenic
No off target data available for this crispr