ID: 1157905388

View in Genome Browser
Species Human (GRCh38)
Location 18:51564852-51564874
Sequence CTTAGGATGGATCTCTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157905378_1157905388 17 Left 1157905378 18:51564812-51564834 CCTGACTCCCTTCCCAAGTTCAG No data
Right 1157905388 18:51564852-51564874 CTTAGGATGGATCTCTGAGTTGG No data
1157905381_1157905388 9 Left 1157905381 18:51564820-51564842 CCTTCCCAAGTTCAGAGGTAAAT No data
Right 1157905388 18:51564852-51564874 CTTAGGATGGATCTCTGAGTTGG No data
1157905380_1157905388 10 Left 1157905380 18:51564819-51564841 CCCTTCCCAAGTTCAGAGGTAAA No data
Right 1157905388 18:51564852-51564874 CTTAGGATGGATCTCTGAGTTGG No data
1157905377_1157905388 20 Left 1157905377 18:51564809-51564831 CCTCCTGACTCCCTTCCCAAGTT No data
Right 1157905388 18:51564852-51564874 CTTAGGATGGATCTCTGAGTTGG No data
1157905382_1157905388 5 Left 1157905382 18:51564824-51564846 CCCAAGTTCAGAGGTAAATTTTC No data
Right 1157905388 18:51564852-51564874 CTTAGGATGGATCTCTGAGTTGG No data
1157905383_1157905388 4 Left 1157905383 18:51564825-51564847 CCAAGTTCAGAGGTAAATTTTCT No data
Right 1157905388 18:51564852-51564874 CTTAGGATGGATCTCTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157905388 Original CRISPR CTTAGGATGGATCTCTGAGT TGG Intergenic