ID: 1157911181

View in Genome Browser
Species Human (GRCh38)
Location 18:51618675-51618697
Sequence ACCATTTAGCTCCCACTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157911180_1157911181 16 Left 1157911180 18:51618636-51618658 CCAAAATGTCTACAAATGAAATC No data
Right 1157911181 18:51618675-51618697 ACCATTTAGCTCCCACTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157911181 Original CRISPR ACCATTTAGCTCCCACTTTA AGG Intergenic
No off target data available for this crispr