ID: 1157912045

View in Genome Browser
Species Human (GRCh38)
Location 18:51625416-51625438
Sequence TGGTGGTCCCAGCATTAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157912045_1157912050 18 Left 1157912045 18:51625416-51625438 CCTGGTTAATGCTGGGACCACCA No data
Right 1157912050 18:51625457-51625479 CTAACATGCTGCATCTCAGCAGG No data
1157912045_1157912051 27 Left 1157912045 18:51625416-51625438 CCTGGTTAATGCTGGGACCACCA No data
Right 1157912051 18:51625466-51625488 TGCATCTCAGCAGGTGAGATCGG No data
1157912045_1157912047 -10 Left 1157912045 18:51625416-51625438 CCTGGTTAATGCTGGGACCACCA No data
Right 1157912047 18:51625429-51625451 GGGACCACCATGGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157912045 Original CRISPR TGGTGGTCCCAGCATTAACC AGG (reversed) Intergenic
No off target data available for this crispr