ID: 1157912047

View in Genome Browser
Species Human (GRCh38)
Location 18:51625429-51625451
Sequence GGGACCACCATGGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157912045_1157912047 -10 Left 1157912045 18:51625416-51625438 CCTGGTTAATGCTGGGACCACCA No data
Right 1157912047 18:51625429-51625451 GGGACCACCATGGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157912047 Original CRISPR GGGACCACCATGGCTGCTGC TGG Intergenic
No off target data available for this crispr