ID: 1157912048

View in Genome Browser
Species Human (GRCh38)
Location 18:51625433-51625455
Sequence GATGCCAGCAGCAGCCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157912048_1157912051 10 Left 1157912048 18:51625433-51625455 CCACCATGGCTGCTGCTGGCATC No data
Right 1157912051 18:51625466-51625488 TGCATCTCAGCAGGTGAGATCGG No data
1157912048_1157912052 16 Left 1157912048 18:51625433-51625455 CCACCATGGCTGCTGCTGGCATC No data
Right 1157912052 18:51625472-51625494 TCAGCAGGTGAGATCGGCACTGG No data
1157912048_1157912053 24 Left 1157912048 18:51625433-51625455 CCACCATGGCTGCTGCTGGCATC No data
Right 1157912053 18:51625480-51625502 TGAGATCGGCACTGGCTCCAAGG No data
1157912048_1157912054 30 Left 1157912048 18:51625433-51625455 CCACCATGGCTGCTGCTGGCATC No data
Right 1157912054 18:51625486-51625508 CGGCACTGGCTCCAAGGAAGAGG No data
1157912048_1157912050 1 Left 1157912048 18:51625433-51625455 CCACCATGGCTGCTGCTGGCATC No data
Right 1157912050 18:51625457-51625479 CTAACATGCTGCATCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157912048 Original CRISPR GATGCCAGCAGCAGCCATGG TGG (reversed) Intergenic
No off target data available for this crispr