ID: 1157912049

View in Genome Browser
Species Human (GRCh38)
Location 18:51625436-51625458
Sequence AGTGATGCCAGCAGCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157912049_1157912053 21 Left 1157912049 18:51625436-51625458 CCATGGCTGCTGCTGGCATCACT No data
Right 1157912053 18:51625480-51625502 TGAGATCGGCACTGGCTCCAAGG No data
1157912049_1157912052 13 Left 1157912049 18:51625436-51625458 CCATGGCTGCTGCTGGCATCACT No data
Right 1157912052 18:51625472-51625494 TCAGCAGGTGAGATCGGCACTGG No data
1157912049_1157912050 -2 Left 1157912049 18:51625436-51625458 CCATGGCTGCTGCTGGCATCACT No data
Right 1157912050 18:51625457-51625479 CTAACATGCTGCATCTCAGCAGG No data
1157912049_1157912051 7 Left 1157912049 18:51625436-51625458 CCATGGCTGCTGCTGGCATCACT No data
Right 1157912051 18:51625466-51625488 TGCATCTCAGCAGGTGAGATCGG No data
1157912049_1157912054 27 Left 1157912049 18:51625436-51625458 CCATGGCTGCTGCTGGCATCACT No data
Right 1157912054 18:51625486-51625508 CGGCACTGGCTCCAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157912049 Original CRISPR AGTGATGCCAGCAGCAGCCA TGG (reversed) Intergenic
No off target data available for this crispr