ID: 1157912050

View in Genome Browser
Species Human (GRCh38)
Location 18:51625457-51625479
Sequence CTAACATGCTGCATCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157912048_1157912050 1 Left 1157912048 18:51625433-51625455 CCACCATGGCTGCTGCTGGCATC No data
Right 1157912050 18:51625457-51625479 CTAACATGCTGCATCTCAGCAGG No data
1157912049_1157912050 -2 Left 1157912049 18:51625436-51625458 CCATGGCTGCTGCTGGCATCACT No data
Right 1157912050 18:51625457-51625479 CTAACATGCTGCATCTCAGCAGG No data
1157912045_1157912050 18 Left 1157912045 18:51625416-51625438 CCTGGTTAATGCTGGGACCACCA No data
Right 1157912050 18:51625457-51625479 CTAACATGCTGCATCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157912050 Original CRISPR CTAACATGCTGCATCTCAGC AGG Intergenic
No off target data available for this crispr