ID: 1157912051

View in Genome Browser
Species Human (GRCh38)
Location 18:51625466-51625488
Sequence TGCATCTCAGCAGGTGAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157912048_1157912051 10 Left 1157912048 18:51625433-51625455 CCACCATGGCTGCTGCTGGCATC No data
Right 1157912051 18:51625466-51625488 TGCATCTCAGCAGGTGAGATCGG No data
1157912045_1157912051 27 Left 1157912045 18:51625416-51625438 CCTGGTTAATGCTGGGACCACCA No data
Right 1157912051 18:51625466-51625488 TGCATCTCAGCAGGTGAGATCGG No data
1157912049_1157912051 7 Left 1157912049 18:51625436-51625458 CCATGGCTGCTGCTGGCATCACT No data
Right 1157912051 18:51625466-51625488 TGCATCTCAGCAGGTGAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157912051 Original CRISPR TGCATCTCAGCAGGTGAGAT CGG Intergenic
No off target data available for this crispr