ID: 1157923019

View in Genome Browser
Species Human (GRCh38)
Location 18:51733267-51733289
Sequence GTGGGCTGATACAGACTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157923019_1157923022 -5 Left 1157923019 18:51733267-51733289 CCCTCAAGTCTGTATCAGCCCAC No data
Right 1157923022 18:51733285-51733307 CCCACCTATGTTTTCCAGTGTGG No data
1157923019_1157923029 29 Left 1157923019 18:51733267-51733289 CCCTCAAGTCTGTATCAGCCCAC No data
Right 1157923029 18:51733319-51733341 TCACTAACTGCATCCTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157923019 Original CRISPR GTGGGCTGATACAGACTTGA GGG (reversed) Intergenic
No off target data available for this crispr