ID: 1157923299

View in Genome Browser
Species Human (GRCh38)
Location 18:51736220-51736242
Sequence ACGTGGTTCCCTTTGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157923295_1157923299 24 Left 1157923295 18:51736173-51736195 CCTTATGACAGTGACAGAAACAA No data
Right 1157923299 18:51736220-51736242 ACGTGGTTCCCTTTGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157923299 Original CRISPR ACGTGGTTCCCTTTGTCTCC AGG Intergenic
No off target data available for this crispr