ID: 1157924767

View in Genome Browser
Species Human (GRCh38)
Location 18:51751680-51751702
Sequence CACTGGCCAAATCAAGTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157924767_1157924771 -2 Left 1157924767 18:51751680-51751702 CCCGTGACTTGATTTGGCCAGTG No data
Right 1157924771 18:51751701-51751723 TGGTTAGAATATGAGCAGACAGG No data
1157924767_1157924772 3 Left 1157924767 18:51751680-51751702 CCCGTGACTTGATTTGGCCAGTG No data
Right 1157924772 18:51751706-51751728 AGAATATGAGCAGACAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157924767 Original CRISPR CACTGGCCAAATCAAGTCAC GGG (reversed) Intergenic
No off target data available for this crispr