ID: 1157925010

View in Genome Browser
Species Human (GRCh38)
Location 18:51754544-51754566
Sequence CAAAGTTAGCCCAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157925006_1157925010 6 Left 1157925006 18:51754515-51754537 CCGAGACAATTACTATGATAAAA No data
Right 1157925010 18:51754544-51754566 CAAAGTTAGCCCAGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157925010 Original CRISPR CAAAGTTAGCCCAGGGAAAC TGG Intergenic
No off target data available for this crispr