ID: 1157927390

View in Genome Browser
Species Human (GRCh38)
Location 18:51781150-51781172
Sequence TAGGGCTCTAAGGAAGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157927383_1157927390 5 Left 1157927383 18:51781122-51781144 CCAGATTGCTAGTAGATTCAGGG No data
Right 1157927390 18:51781150-51781172 TAGGGCTCTAAGGAAGCTGGTGG No data
1157927379_1157927390 23 Left 1157927379 18:51781104-51781126 CCAACCGTGCCAGCTTCTCCAGA No data
Right 1157927390 18:51781150-51781172 TAGGGCTCTAAGGAAGCTGGTGG No data
1157927380_1157927390 19 Left 1157927380 18:51781108-51781130 CCGTGCCAGCTTCTCCAGATTGC No data
Right 1157927390 18:51781150-51781172 TAGGGCTCTAAGGAAGCTGGTGG No data
1157927381_1157927390 14 Left 1157927381 18:51781113-51781135 CCAGCTTCTCCAGATTGCTAGTA No data
Right 1157927390 18:51781150-51781172 TAGGGCTCTAAGGAAGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157927390 Original CRISPR TAGGGCTCTAAGGAAGCTGG TGG Intergenic
No off target data available for this crispr