ID: 1157928424

View in Genome Browser
Species Human (GRCh38)
Location 18:51791660-51791682
Sequence AGTGATATGTGGACTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157928424_1157928432 20 Left 1157928424 18:51791660-51791682 CCATCCCCAGTCCACATATCACT No data
Right 1157928432 18:51791703-51791725 CTTCCTCAACCCCAAATAAAAGG No data
1157928424_1157928434 28 Left 1157928424 18:51791660-51791682 CCATCCCCAGTCCACATATCACT No data
Right 1157928434 18:51791711-51791733 ACCCCAAATAAAAGGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157928424 Original CRISPR AGTGATATGTGGACTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr