ID: 1157930028

View in Genome Browser
Species Human (GRCh38)
Location 18:51811647-51811669
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157930026_1157930028 6 Left 1157930026 18:51811618-51811640 CCAAGTGCTATAACATCTAACTT No data
Right 1157930028 18:51811647-51811669 TAAGCTAGACAGTTTGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157930028 Original CRISPR TAAGCTAGACAGTTTGTTCT TGG Intergenic
No off target data available for this crispr