ID: 1157934511

View in Genome Browser
Species Human (GRCh38)
Location 18:51858403-51858425
Sequence TTGGGTACCCAGAAATATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157934507_1157934511 24 Left 1157934507 18:51858356-51858378 CCATCTGTCTAGGAGGGAGGTCT No data
Right 1157934511 18:51858403-51858425 TTGGGTACCCAGAAATATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157934511 Original CRISPR TTGGGTACCCAGAAATATGA AGG Intergenic
No off target data available for this crispr