ID: 1157936105

View in Genome Browser
Species Human (GRCh38)
Location 18:51874576-51874598
Sequence GGGGCCTCACCCCATTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157936097_1157936105 14 Left 1157936097 18:51874539-51874561 CCTACTGCTGAGGCGATTTCCAC No data
Right 1157936105 18:51874576-51874598 GGGGCCTCACCCCATTCCAGAGG No data
1157936104_1157936105 -5 Left 1157936104 18:51874558-51874580 CCACAGTTCTGGCTGTGGGGGGC No data
Right 1157936105 18:51874576-51874598 GGGGCCTCACCCCATTCCAGAGG No data
1157936096_1157936105 15 Left 1157936096 18:51874538-51874560 CCCTACTGCTGAGGCGATTTCCA No data
Right 1157936105 18:51874576-51874598 GGGGCCTCACCCCATTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157936105 Original CRISPR GGGGCCTCACCCCATTCCAG AGG Intergenic
No off target data available for this crispr