ID: 1157941301

View in Genome Browser
Species Human (GRCh38)
Location 18:51931683-51931705
Sequence CTGGAGGTTCCAGCCTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157941294_1157941301 4 Left 1157941294 18:51931656-51931678 CCAAGACCTGTGAGTCTTTTAGG No data
Right 1157941301 18:51931683-51931705 CTGGAGGTTCCAGCCTATGAGGG No data
1157941293_1157941301 15 Left 1157941293 18:51931645-51931667 CCTGGCAGGCTCCAAGACCTGTG No data
Right 1157941301 18:51931683-51931705 CTGGAGGTTCCAGCCTATGAGGG No data
1157941297_1157941301 -2 Left 1157941297 18:51931662-51931684 CCTGTGAGTCTTTTAGGGTAGCT No data
Right 1157941301 18:51931683-51931705 CTGGAGGTTCCAGCCTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157941301 Original CRISPR CTGGAGGTTCCAGCCTATGA GGG Intergenic
No off target data available for this crispr