ID: 1157942005

View in Genome Browser
Species Human (GRCh38)
Location 18:51939489-51939511
Sequence CAGCATGAGCAGAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157942002_1157942005 -9 Left 1157942002 18:51939475-51939497 CCAGACAGTAGAAACAGCATGAG No data
Right 1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG No data
1157942001_1157942005 -5 Left 1157942001 18:51939471-51939493 CCTTCCAGACAGTAGAAACAGCA No data
Right 1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157942005 Original CRISPR CAGCATGAGCAGAGGCAGGA TGG Intergenic
No off target data available for this crispr