ID: 1157943534

View in Genome Browser
Species Human (GRCh38)
Location 18:51954838-51954860
Sequence CCTCATGGGTTCATAGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157943534_1157943538 14 Left 1157943534 18:51954838-51954860 CCTATAGCTATGAACCCATGAGG No data
Right 1157943538 18:51954875-51954897 TTTTTTAGTACAATACTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157943534 Original CRISPR CCTCATGGGTTCATAGCTAT AGG (reversed) Intergenic
No off target data available for this crispr