ID: 1157944142

View in Genome Browser
Species Human (GRCh38)
Location 18:51959673-51959695
Sequence AGATATAGGCCCCTATCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157944142_1157944146 7 Left 1157944142 18:51959673-51959695 CCACACGATAGGGGCCTATATCT No data
Right 1157944146 18:51959703-51959725 ACTGTTCAGAAGATCACATGGGG No data
1157944142_1157944144 5 Left 1157944142 18:51959673-51959695 CCACACGATAGGGGCCTATATCT No data
Right 1157944144 18:51959701-51959723 GAACTGTTCAGAAGATCACATGG No data
1157944142_1157944145 6 Left 1157944142 18:51959673-51959695 CCACACGATAGGGGCCTATATCT No data
Right 1157944145 18:51959702-51959724 AACTGTTCAGAAGATCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157944142 Original CRISPR AGATATAGGCCCCTATCGTG TGG (reversed) Intergenic
No off target data available for this crispr