ID: 1157944533

View in Genome Browser
Species Human (GRCh38)
Location 18:51964257-51964279
Sequence AGTGAGCCAGGCACAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157944533_1157944540 11 Left 1157944533 18:51964257-51964279 CCTGCCTCTGTGCCTGGCTCACT No data
Right 1157944540 18:51964291-51964313 ACTCAGGGAAAAGATTTCTTGGG No data
1157944533_1157944541 26 Left 1157944533 18:51964257-51964279 CCTGCCTCTGTGCCTGGCTCACT No data
Right 1157944541 18:51964306-51964328 TTCTTGGGAGAACTTCATTCAGG No data
1157944533_1157944542 30 Left 1157944533 18:51964257-51964279 CCTGCCTCTGTGCCTGGCTCACT No data
Right 1157944542 18:51964310-51964332 TGGGAGAACTTCATTCAGGTCGG No data
1157944533_1157944537 -4 Left 1157944533 18:51964257-51964279 CCTGCCTCTGTGCCTGGCTCACT No data
Right 1157944537 18:51964276-51964298 CACTACTGCCTTTGCACTCAGGG No data
1157944533_1157944536 -5 Left 1157944533 18:51964257-51964279 CCTGCCTCTGTGCCTGGCTCACT No data
Right 1157944536 18:51964275-51964297 TCACTACTGCCTTTGCACTCAGG No data
1157944533_1157944539 10 Left 1157944533 18:51964257-51964279 CCTGCCTCTGTGCCTGGCTCACT No data
Right 1157944539 18:51964290-51964312 CACTCAGGGAAAAGATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157944533 Original CRISPR AGTGAGCCAGGCACAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr