ID: 1157944535

View in Genome Browser
Species Human (GRCh38)
Location 18:51964269-51964291
Sequence TGCAAAGGCAGTAGTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157944535_1157944540 -1 Left 1157944535 18:51964269-51964291 CCTGGCTCACTACTGCCTTTGCA No data
Right 1157944540 18:51964291-51964313 ACTCAGGGAAAAGATTTCTTGGG No data
1157944535_1157944543 19 Left 1157944535 18:51964269-51964291 CCTGGCTCACTACTGCCTTTGCA No data
Right 1157944543 18:51964311-51964333 GGGAGAACTTCATTCAGGTCGGG No data
1157944535_1157944542 18 Left 1157944535 18:51964269-51964291 CCTGGCTCACTACTGCCTTTGCA No data
Right 1157944542 18:51964310-51964332 TGGGAGAACTTCATTCAGGTCGG No data
1157944535_1157944541 14 Left 1157944535 18:51964269-51964291 CCTGGCTCACTACTGCCTTTGCA No data
Right 1157944541 18:51964306-51964328 TTCTTGGGAGAACTTCATTCAGG No data
1157944535_1157944539 -2 Left 1157944535 18:51964269-51964291 CCTGGCTCACTACTGCCTTTGCA No data
Right 1157944539 18:51964290-51964312 CACTCAGGGAAAAGATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157944535 Original CRISPR TGCAAAGGCAGTAGTGAGCC AGG (reversed) Intergenic
No off target data available for this crispr