ID: 1157944537

View in Genome Browser
Species Human (GRCh38)
Location 18:51964276-51964298
Sequence CACTACTGCCTTTGCACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157944534_1157944537 -8 Left 1157944534 18:51964261-51964283 CCTCTGTGCCTGGCTCACTACTG No data
Right 1157944537 18:51964276-51964298 CACTACTGCCTTTGCACTCAGGG No data
1157944531_1157944537 17 Left 1157944531 18:51964236-51964258 CCATGACTCATATTCTTCATACC No data
Right 1157944537 18:51964276-51964298 CACTACTGCCTTTGCACTCAGGG No data
1157944530_1157944537 18 Left 1157944530 18:51964235-51964257 CCCATGACTCATATTCTTCATAC No data
Right 1157944537 18:51964276-51964298 CACTACTGCCTTTGCACTCAGGG No data
1157944533_1157944537 -4 Left 1157944533 18:51964257-51964279 CCTGCCTCTGTGCCTGGCTCACT No data
Right 1157944537 18:51964276-51964298 CACTACTGCCTTTGCACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157944537 Original CRISPR CACTACTGCCTTTGCACTCA GGG Intergenic
No off target data available for this crispr