ID: 1157944538

View in Genome Browser
Species Human (GRCh38)
Location 18:51964284-51964306
Sequence AATCTTTTCCCTGAGTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157944538_1157944544 17 Left 1157944538 18:51964284-51964306 CCTTTGCACTCAGGGAAAAGATT No data
Right 1157944544 18:51964324-51964346 TCAGGTCGGGTCAGCTCCTCAGG No data
1157944538_1157944542 3 Left 1157944538 18:51964284-51964306 CCTTTGCACTCAGGGAAAAGATT No data
Right 1157944542 18:51964310-51964332 TGGGAGAACTTCATTCAGGTCGG No data
1157944538_1157944541 -1 Left 1157944538 18:51964284-51964306 CCTTTGCACTCAGGGAAAAGATT No data
Right 1157944541 18:51964306-51964328 TTCTTGGGAGAACTTCATTCAGG No data
1157944538_1157944543 4 Left 1157944538 18:51964284-51964306 CCTTTGCACTCAGGGAAAAGATT No data
Right 1157944543 18:51964311-51964333 GGGAGAACTTCATTCAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157944538 Original CRISPR AATCTTTTCCCTGAGTGCAA AGG (reversed) Intergenic
No off target data available for this crispr