ID: 1157944539

View in Genome Browser
Species Human (GRCh38)
Location 18:51964290-51964312
Sequence CACTCAGGGAAAAGATTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157944534_1157944539 6 Left 1157944534 18:51964261-51964283 CCTCTGTGCCTGGCTCACTACTG No data
Right 1157944539 18:51964290-51964312 CACTCAGGGAAAAGATTTCTTGG No data
1157944535_1157944539 -2 Left 1157944535 18:51964269-51964291 CCTGGCTCACTACTGCCTTTGCA No data
Right 1157944539 18:51964290-51964312 CACTCAGGGAAAAGATTTCTTGG No data
1157944533_1157944539 10 Left 1157944533 18:51964257-51964279 CCTGCCTCTGTGCCTGGCTCACT No data
Right 1157944539 18:51964290-51964312 CACTCAGGGAAAAGATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157944539 Original CRISPR CACTCAGGGAAAAGATTTCT TGG Intergenic
No off target data available for this crispr