ID: 1157944543

View in Genome Browser
Species Human (GRCh38)
Location 18:51964311-51964333
Sequence GGGAGAACTTCATTCAGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157944534_1157944543 27 Left 1157944534 18:51964261-51964283 CCTCTGTGCCTGGCTCACTACTG No data
Right 1157944543 18:51964311-51964333 GGGAGAACTTCATTCAGGTCGGG No data
1157944538_1157944543 4 Left 1157944538 18:51964284-51964306 CCTTTGCACTCAGGGAAAAGATT No data
Right 1157944543 18:51964311-51964333 GGGAGAACTTCATTCAGGTCGGG No data
1157944535_1157944543 19 Left 1157944535 18:51964269-51964291 CCTGGCTCACTACTGCCTTTGCA No data
Right 1157944543 18:51964311-51964333 GGGAGAACTTCATTCAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157944543 Original CRISPR GGGAGAACTTCATTCAGGTC GGG Intergenic
No off target data available for this crispr