ID: 1157944544

View in Genome Browser
Species Human (GRCh38)
Location 18:51964324-51964346
Sequence TCAGGTCGGGTCAGCTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157944538_1157944544 17 Left 1157944538 18:51964284-51964306 CCTTTGCACTCAGGGAAAAGATT No data
Right 1157944544 18:51964324-51964346 TCAGGTCGGGTCAGCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157944544 Original CRISPR TCAGGTCGGGTCAGCTCCTC AGG Intergenic
No off target data available for this crispr