ID: 1157952747

View in Genome Browser
Species Human (GRCh38)
Location 18:52057939-52057961
Sequence GTGGGGGAGCCCATCATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157952746_1157952747 -10 Left 1157952746 18:52057926-52057948 CCAGTTACTTTCAGTGGGGGAGC No data
Right 1157952747 18:52057939-52057961 GTGGGGGAGCCCATCATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157952747 Original CRISPR GTGGGGGAGCCCATCATTAC TGG Intergenic
No off target data available for this crispr