ID: 1157952888

View in Genome Browser
Species Human (GRCh38)
Location 18:52060108-52060130
Sequence AACTGAGGGCTGGAGTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157952888_1157952892 22 Left 1157952888 18:52060108-52060130 CCTCTATACTCCAGCCCTCAGTT No data
Right 1157952892 18:52060153-52060175 TAATGTTGTTATGATCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157952888 Original CRISPR AACTGAGGGCTGGAGTATAG AGG (reversed) Intergenic
No off target data available for this crispr