ID: 1157955185

View in Genome Browser
Species Human (GRCh38)
Location 18:52089121-52089143
Sequence AGGTAAGGACAGAGGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157955185_1157955193 8 Left 1157955185 18:52089121-52089143 CCTAGCTCCCTCTGTCCTTACCT No data
Right 1157955193 18:52089152-52089174 CATGAACAAAGTGGCCAGCATGG No data
1157955185_1157955197 20 Left 1157955185 18:52089121-52089143 CCTAGCTCCCTCTGTCCTTACCT No data
Right 1157955197 18:52089164-52089186 GGCCAGCATGGCAGAGGGGAAGG No data
1157955185_1157955196 16 Left 1157955185 18:52089121-52089143 CCTAGCTCCCTCTGTCCTTACCT No data
Right 1157955196 18:52089160-52089182 AAGTGGCCAGCATGGCAGAGGGG No data
1157955185_1157955192 -1 Left 1157955185 18:52089121-52089143 CCTAGCTCCCTCTGTCCTTACCT No data
Right 1157955192 18:52089143-52089165 TAATGGGCTCATGAACAAAGTGG 0: 3
1: 41
2: 212
3: 276
4: 386
1157955185_1157955194 14 Left 1157955185 18:52089121-52089143 CCTAGCTCCCTCTGTCCTTACCT No data
Right 1157955194 18:52089158-52089180 CAAAGTGGCCAGCATGGCAGAGG No data
1157955185_1157955195 15 Left 1157955185 18:52089121-52089143 CCTAGCTCCCTCTGTCCTTACCT No data
Right 1157955195 18:52089159-52089181 AAAGTGGCCAGCATGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157955185 Original CRISPR AGGTAAGGACAGAGGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr