ID: 1157955286

View in Genome Browser
Species Human (GRCh38)
Location 18:52090151-52090173
Sequence CCTAACAACCCAAGCCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157955281_1157955286 28 Left 1157955281 18:52090100-52090122 CCTCTAATCAAAGTCAATTAAAA No data
Right 1157955286 18:52090151-52090173 CCTAACAACCCAAGCCCTTAAGG No data
1157955284_1157955286 -6 Left 1157955284 18:52090134-52090156 CCAGTATAGGCAGGACTCCTAAC No data
Right 1157955286 18:52090151-52090173 CCTAACAACCCAAGCCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157955286 Original CRISPR CCTAACAACCCAAGCCCTTA AGG Intergenic
No off target data available for this crispr