ID: 1157966179

View in Genome Browser
Species Human (GRCh38)
Location 18:52210984-52211006
Sequence ATGCCTCATGGATCAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157966179_1157966184 -2 Left 1157966179 18:52210984-52211006 CCCTGAGCTGATCCATGAGGCAT No data
Right 1157966184 18:52211005-52211027 ATGAGCAGGATTTAGGATCCAGG No data
1157966179_1157966185 1 Left 1157966179 18:52210984-52211006 CCCTGAGCTGATCCATGAGGCAT No data
Right 1157966185 18:52211008-52211030 AGCAGGATTTAGGATCCAGGTGG No data
1157966179_1157966187 5 Left 1157966179 18:52210984-52211006 CCCTGAGCTGATCCATGAGGCAT No data
Right 1157966187 18:52211012-52211034 GGATTTAGGATCCAGGTGGTGGG No data
1157966179_1157966189 14 Left 1157966179 18:52210984-52211006 CCCTGAGCTGATCCATGAGGCAT No data
Right 1157966189 18:52211021-52211043 ATCCAGGTGGTGGGCAGAGAGGG No data
1157966179_1157966186 4 Left 1157966179 18:52210984-52211006 CCCTGAGCTGATCCATGAGGCAT No data
Right 1157966186 18:52211011-52211033 AGGATTTAGGATCCAGGTGGTGG No data
1157966179_1157966191 17 Left 1157966179 18:52210984-52211006 CCCTGAGCTGATCCATGAGGCAT No data
Right 1157966191 18:52211024-52211046 CAGGTGGTGGGCAGAGAGGGAGG No data
1157966179_1157966188 13 Left 1157966179 18:52210984-52211006 CCCTGAGCTGATCCATGAGGCAT No data
Right 1157966188 18:52211020-52211042 GATCCAGGTGGTGGGCAGAGAGG No data
1157966179_1157966183 -9 Left 1157966179 18:52210984-52211006 CCCTGAGCTGATCCATGAGGCAT No data
Right 1157966183 18:52210998-52211020 ATGAGGCATGAGCAGGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157966179 Original CRISPR ATGCCTCATGGATCAGCTCA GGG (reversed) Intergenic