ID: 1157966180

View in Genome Browser
Species Human (GRCh38)
Location 18:52210985-52211007
Sequence CATGCCTCATGGATCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157966180_1157966188 12 Left 1157966180 18:52210985-52211007 CCTGAGCTGATCCATGAGGCATG No data
Right 1157966188 18:52211020-52211042 GATCCAGGTGGTGGGCAGAGAGG No data
1157966180_1157966187 4 Left 1157966180 18:52210985-52211007 CCTGAGCTGATCCATGAGGCATG No data
Right 1157966187 18:52211012-52211034 GGATTTAGGATCCAGGTGGTGGG No data
1157966180_1157966189 13 Left 1157966180 18:52210985-52211007 CCTGAGCTGATCCATGAGGCATG No data
Right 1157966189 18:52211021-52211043 ATCCAGGTGGTGGGCAGAGAGGG No data
1157966180_1157966185 0 Left 1157966180 18:52210985-52211007 CCTGAGCTGATCCATGAGGCATG No data
Right 1157966185 18:52211008-52211030 AGCAGGATTTAGGATCCAGGTGG No data
1157966180_1157966186 3 Left 1157966180 18:52210985-52211007 CCTGAGCTGATCCATGAGGCATG No data
Right 1157966186 18:52211011-52211033 AGGATTTAGGATCCAGGTGGTGG No data
1157966180_1157966191 16 Left 1157966180 18:52210985-52211007 CCTGAGCTGATCCATGAGGCATG No data
Right 1157966191 18:52211024-52211046 CAGGTGGTGGGCAGAGAGGGAGG No data
1157966180_1157966183 -10 Left 1157966180 18:52210985-52211007 CCTGAGCTGATCCATGAGGCATG No data
Right 1157966183 18:52210998-52211020 ATGAGGCATGAGCAGGATTTAGG No data
1157966180_1157966184 -3 Left 1157966180 18:52210985-52211007 CCTGAGCTGATCCATGAGGCATG No data
Right 1157966184 18:52211005-52211027 ATGAGCAGGATTTAGGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157966180 Original CRISPR CATGCCTCATGGATCAGCTC AGG (reversed) Intergenic