ID: 1157966182

View in Genome Browser
Species Human (GRCh38)
Location 18:52210996-52211018
Sequence TAAATCCTGCTCATGCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157966182_1157966191 5 Left 1157966182 18:52210996-52211018 CCATGAGGCATGAGCAGGATTTA No data
Right 1157966191 18:52211024-52211046 CAGGTGGTGGGCAGAGAGGGAGG No data
1157966182_1157966192 26 Left 1157966182 18:52210996-52211018 CCATGAGGCATGAGCAGGATTTA No data
Right 1157966192 18:52211045-52211067 GGACATTCCAAGTAATGAGCTGG No data
1157966182_1157966187 -7 Left 1157966182 18:52210996-52211018 CCATGAGGCATGAGCAGGATTTA No data
Right 1157966187 18:52211012-52211034 GGATTTAGGATCCAGGTGGTGGG No data
1157966182_1157966186 -8 Left 1157966182 18:52210996-52211018 CCATGAGGCATGAGCAGGATTTA No data
Right 1157966186 18:52211011-52211033 AGGATTTAGGATCCAGGTGGTGG No data
1157966182_1157966188 1 Left 1157966182 18:52210996-52211018 CCATGAGGCATGAGCAGGATTTA No data
Right 1157966188 18:52211020-52211042 GATCCAGGTGGTGGGCAGAGAGG No data
1157966182_1157966189 2 Left 1157966182 18:52210996-52211018 CCATGAGGCATGAGCAGGATTTA No data
Right 1157966189 18:52211021-52211043 ATCCAGGTGGTGGGCAGAGAGGG No data
1157966182_1157966193 27 Left 1157966182 18:52210996-52211018 CCATGAGGCATGAGCAGGATTTA No data
Right 1157966193 18:52211046-52211068 GACATTCCAAGTAATGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157966182 Original CRISPR TAAATCCTGCTCATGCCTCA TGG (reversed) Intergenic