ID: 1157966188

View in Genome Browser
Species Human (GRCh38)
Location 18:52211020-52211042
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157966180_1157966188 12 Left 1157966180 18:52210985-52211007 CCTGAGCTGATCCATGAGGCATG No data
Right 1157966188 18:52211020-52211042 GATCCAGGTGGTGGGCAGAGAGG No data
1157966179_1157966188 13 Left 1157966179 18:52210984-52211006 CCCTGAGCTGATCCATGAGGCAT No data
Right 1157966188 18:52211020-52211042 GATCCAGGTGGTGGGCAGAGAGG No data
1157966182_1157966188 1 Left 1157966182 18:52210996-52211018 CCATGAGGCATGAGCAGGATTTA No data
Right 1157966188 18:52211020-52211042 GATCCAGGTGGTGGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157966188 Original CRISPR GATCCAGGTGGTGGGCAGAG AGG Intergenic
No off target data available for this crispr