ID: 1157966188 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:52211020-52211042 |
Sequence | GATCCAGGTGGTGGGCAGAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1157966180_1157966188 | 12 | Left | 1157966180 | 18:52210985-52211007 | CCTGAGCTGATCCATGAGGCATG | No data | ||
Right | 1157966188 | 18:52211020-52211042 | GATCCAGGTGGTGGGCAGAGAGG | No data | ||||
1157966179_1157966188 | 13 | Left | 1157966179 | 18:52210984-52211006 | CCCTGAGCTGATCCATGAGGCAT | No data | ||
Right | 1157966188 | 18:52211020-52211042 | GATCCAGGTGGTGGGCAGAGAGG | No data | ||||
1157966182_1157966188 | 1 | Left | 1157966182 | 18:52210996-52211018 | CCATGAGGCATGAGCAGGATTTA | No data | ||
Right | 1157966188 | 18:52211020-52211042 | GATCCAGGTGGTGGGCAGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1157966188 | Original CRISPR | GATCCAGGTGGTGGGCAGAG AGG | Intergenic | ||