ID: 1157971855

View in Genome Browser
Species Human (GRCh38)
Location 18:52279517-52279539
Sequence TCCTCACCATGTCAAATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157971855_1157971856 9 Left 1157971855 18:52279517-52279539 CCTTACATTTGACATGGTGAGGA No data
Right 1157971856 18:52279549-52279571 ACAGCACGTATTTGTACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157971855 Original CRISPR TCCTCACCATGTCAAATGTA AGG (reversed) Intergenic
No off target data available for this crispr