ID: 1157980110

View in Genome Browser
Species Human (GRCh38)
Location 18:52369935-52369957
Sequence CTGTATGTTTGGATAAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 590}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157980110 Original CRISPR CTGTATGTTTGGATAAGATG AGG (reversed) Intronic
900235450 1:1587562-1587584 TTGTATTTTTGGTAAAGATGGGG + Intergenic
900998856 1:6137442-6137464 TTGTATGTTTTGTTAGGATGAGG - Intronic
901043910 1:6383876-6383898 TTGTATTTTTGGTAAAGATGGGG + Intronic
902319833 1:15653667-15653689 CTGTATTTTTTGTAAAGATGAGG + Intronic
902324231 1:15688477-15688499 CTGTATTTTTGGTAGAGATGGGG - Intronic
903064805 1:20693436-20693458 TTGTATTTTTGGTAAAGATGGGG + Intronic
903727562 1:25462154-25462176 CTGTATGTTTGCATCAGAAGGGG - Intronic
904061947 1:27718366-27718388 CTGTATTATTGGTTGAGATGGGG + Intergenic
904502030 1:30918742-30918764 TTGTATTTTTAGAAAAGATGGGG + Intergenic
904608396 1:31711449-31711471 AGGGATGTTTGGATAAGGTGTGG - Intergenic
905125221 1:35711368-35711390 TTGTATGTTTGGTAAAGATGGGG - Intergenic
905507788 1:38493862-38493884 TTGTATGTTTAGAAGAGATGGGG + Intergenic
905695518 1:39970657-39970679 CTGGATGTGTGTATCAGATGAGG + Intergenic
906173638 1:43749562-43749584 TTGTTTGTTTGTTTAAGATGGGG - Intronic
906367802 1:45225521-45225543 TTGTATTTTTGGAAGAGATGGGG - Intronic
906373415 1:45273952-45273974 TTGTATTTTTGGTAAAGATGAGG + Intronic
906400942 1:45504240-45504262 CTGTATTTTTAGTTGAGATGGGG - Intronic
906898159 1:49802273-49802295 CTGTCTATATGGATAAGATAGGG + Intronic
907214698 1:52852219-52852241 TTGTATTTTTGGTGAAGATGGGG + Intronic
907353629 1:53854075-53854097 CTGTATTTTTGGTAGAGATGGGG - Intronic
907494457 1:54834008-54834030 TTGTATTTTTGGTAAAGATGGGG + Intronic
910222712 1:84904419-84904441 CTGTATGTTTTGTAGAGATGGGG - Intergenic
910436681 1:87212386-87212408 CTGTCAGGGTGGATAAGATGAGG + Intergenic
910465431 1:87494089-87494111 CTGATTGGTTGCATAAGATGAGG + Intergenic
910731362 1:90400709-90400731 CTGTTTGTTTGGATAATCTTGGG + Intergenic
910909860 1:92222063-92222085 TTGTATTTTTAGTTAAGATGGGG - Intronic
910978349 1:92932266-92932288 TTGTATGTTTGGTAGAGATGGGG - Intronic
912780109 1:112538515-112538537 TTGTATATTTGGAAGAGATGGGG + Intronic
913307992 1:117452132-117452154 CTGTATTTTTAGTAAAGATGGGG - Intronic
913376141 1:118154674-118154696 CTGCATGTTGGGATAGGATATGG - Intronic
914360247 1:146929187-146929209 CTGATTGTTTGCATAAAATGAGG + Intergenic
914493501 1:148170710-148170732 CTGATTGTTTGCATAAAATGAGG - Intergenic
914820197 1:151095859-151095881 CTGTATTTTTAGTAAAGATGAGG - Intronic
914886851 1:151592472-151592494 TTGTATTTTTGGAAGAGATGGGG - Intergenic
915055085 1:153121792-153121814 TTGTATTTTTGGTAAAGATGAGG - Intergenic
916095118 1:161342687-161342709 TTGTATTTTTGGTAAAGATGGGG + Intronic
916097516 1:161364414-161364436 ATGTGTGTTTGGAGAAGGTGGGG - Exonic
916224673 1:162477554-162477576 CTGTATTTTTGGTAGAGATGAGG - Intergenic
916570520 1:166022051-166022073 TTGTTTGTTTGCATAAGTTGAGG - Intergenic
916680617 1:167101629-167101651 TTGTATTTTTAGTTAAGATGGGG - Intronic
917104938 1:171483059-171483081 TTGTATTTTTGGTTGAGATGGGG - Intergenic
917203808 1:172546734-172546756 TTGTATTTTTGGAAGAGATGGGG - Intronic
917368423 1:174260005-174260027 TTGTATGTTTAGTAAAGATGGGG + Intronic
918021537 1:180697623-180697645 CTGTAGGTTTGGGTATGTTGTGG + Intronic
919203469 1:194390109-194390131 CTGTATATTTGAGGAAGATGAGG - Intergenic
919682162 1:200446352-200446374 TTGTATGTTTTGAAGAGATGTGG + Intergenic
920030625 1:203035391-203035413 CTGTGTGTTAGGAAAAGGTGGGG + Intronic
920139092 1:203794892-203794914 TTGTATTTTTGGTAAAGATGAGG + Intergenic
920216740 1:204366586-204366608 TTGTATTTTTGGTCAAGATGGGG - Intronic
920334312 1:205234269-205234291 CTGTATTTTTGGTAGAGATGGGG - Intronic
920820394 1:209374876-209374898 TTGTATTTTTAGAAAAGATGGGG - Intergenic
920842154 1:209563956-209563978 GTGTATGTTTGGGTATGAGGAGG - Intergenic
921450751 1:215302836-215302858 TTGTATTTTTGGTAAAGATGGGG - Intergenic
921703211 1:218290639-218290661 TTGTATTTTTGGAAGAGATGAGG + Intronic
921862276 1:220052381-220052403 CTGTATTTTTGGTAGAGATGGGG + Intergenic
921981787 1:221266636-221266658 CTTGACATTTGGATAAGATGGGG + Intergenic
922714919 1:227864360-227864382 TTGTATTTTTGGTAAAGATGGGG - Intergenic
923537211 1:234862540-234862562 CTGCATGTTTTTAAAAGATGAGG + Intergenic
1063037331 10:2299474-2299496 CTGTGTGTTAGGACAAGATGTGG + Intergenic
1063529043 10:6812395-6812417 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1063891315 10:10631589-10631611 CTGTATGTGAGGGAAAGATGGGG + Intergenic
1064043599 10:11990504-11990526 TTGTATTTTTGGTTGAGATGGGG - Intronic
1064062188 10:12147510-12147532 CTGTATTTTTGGTAGAGATGGGG - Intronic
1064655634 10:17552710-17552732 CTGAATGTTTTCATAGGATGGGG - Intergenic
1064724742 10:18267431-18267453 CTGTATGTTTAGTAGAGATGGGG - Intronic
1064988045 10:21230775-21230797 CTGTATTTTTGGTAGAGATGGGG + Intergenic
1065569825 10:27059086-27059108 TTGTATTTTTGGTAAAGATGGGG + Intronic
1066381109 10:34901897-34901919 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1066403544 10:35097784-35097806 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1066604223 10:37143479-37143501 CTGTATTTTTAGTAAAGATGAGG - Intronic
1067246447 10:44550642-44550664 TTCTATGTTTGGAAAATATGAGG + Intergenic
1067316863 10:45175949-45175971 CTGTTTATATGGATAAGATGGGG - Intergenic
1067407907 10:46039707-46039729 TTGTATTTTTGGTAAAGATGGGG - Intronic
1068742710 10:60492531-60492553 TTGTATTTTTGGTTAAGATGGGG - Intronic
1068781193 10:60920826-60920848 TTGTATTTTTGGTAAAGATGGGG + Intronic
1070028718 10:72656587-72656609 TTGTATGTTTGGCAGAGATGGGG - Intergenic
1071224761 10:83515877-83515899 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1071812471 10:89198534-89198556 CTGTATTTTTAGTAAAGATGGGG - Intergenic
1072330355 10:94342910-94342932 CTGTATTTTTAGTAAAGATGGGG - Intronic
1072408742 10:95180818-95180840 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1072827158 10:98618747-98618769 TTGTATGTTTAGTAAAGATGGGG + Intronic
1072937820 10:99730409-99730431 TTGTATTTTTGGTAAAGATGGGG - Intronic
1072969316 10:100003170-100003192 TTGTATTTTTGGTAAAGATGGGG - Intronic
1073154271 10:101334111-101334133 TTGTATTTTTGGTGAAGATGGGG + Intergenic
1073165096 10:101440546-101440568 TTGTATTTTTGGTAAAGATGGGG - Intronic
1074287674 10:112113708-112113730 TTGTATTTTTAGAAAAGATGGGG - Intergenic
1074495359 10:113975587-113975609 CTGTATTTTTAGTAAAGATGGGG + Intergenic
1074572512 10:114636858-114636880 TTGTATTTTTGGAAGAGATGGGG - Intronic
1074946743 10:118287285-118287307 CTGCATGTCTGGACCAGATGCGG - Intergenic
1077099255 11:814314-814336 TTGTATTTTTAGAAAAGATGGGG + Intergenic
1077572266 11:3349790-3349812 CTGTATTTTTAGTAAAGATGGGG + Intronic
1078078807 11:8187719-8187741 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1078383366 11:10864160-10864182 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1078657753 11:13258012-13258034 TTGTATTTTTGGAAGAGATGGGG - Intergenic
1080390452 11:31841199-31841221 CTGTATTTTTTGTGAAGATGAGG + Intronic
1080536170 11:33223783-33223805 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1081398410 11:42614249-42614271 CTGTATTTTTAGAAGAGATGGGG + Intergenic
1081512834 11:43793324-43793346 CTGTTTATTTGGAGCAGATGTGG + Intronic
1082265176 11:50110228-50110250 TTGTATGTTTGGTAGAGATGGGG - Intergenic
1082279824 11:50259902-50259924 CTGTATTTTTGGTAGAGATGGGG - Intergenic
1082774449 11:57234828-57234850 CAGTATGATGGGGTAAGATGGGG + Exonic
1082944360 11:58741935-58741957 TGGTATCTTAGGATAAGATGTGG + Intergenic
1083018542 11:59481997-59482019 CTGTATGTTTGGTAGAGATGGGG - Intergenic
1083075730 11:60035206-60035228 CTGTCTGTTTGTGTAAGATTTGG - Intergenic
1083801593 11:65049191-65049213 CTGTATTTTTGGTAGAGATGGGG + Intronic
1084237156 11:67795693-67795715 CTGTATGTTTTGTGGAGATGGGG + Intergenic
1084643380 11:70439348-70439370 TTGTATTTTTAGTTAAGATGGGG + Intergenic
1084835252 11:71797137-71797159 CTGTAAGTTTTGTGAAGATGGGG - Intronic
1085012371 11:73150118-73150140 CTGTTTGTTTGATTGAGATGGGG + Intergenic
1085091561 11:73719786-73719808 TTGTATTTTTAGAAAAGATGGGG + Intronic
1085332116 11:75661691-75661713 CTTTATGTTTTTATAAGATAAGG - Intronic
1085352761 11:75810628-75810650 GTGAATGTTTGGATCACATGGGG - Intergenic
1086921776 11:92595655-92595677 CTGTACCTTGGAATAAGATGTGG - Intronic
1087035585 11:93752918-93752940 TTGTATTTTTGGTAAAGATGGGG + Intronic
1087185626 11:95190782-95190804 CTATATATTTGGAGAAGTTGGGG - Intronic
1087488514 11:98790981-98791003 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1088537040 11:110872650-110872672 CTGGATGTGGGGGTAAGATGGGG - Intergenic
1089037152 11:115406772-115406794 TTGTATGTTTAGTTGAGATGGGG - Intronic
1089955618 11:122568366-122568388 CTGTATTTTTGGTAGAGATGGGG - Intergenic
1090033273 11:123225874-123225896 CTTCATGTTTGGAGAAGATGGGG - Intergenic
1092404894 12:8213782-8213804 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1092407816 12:8233283-8233305 CTGTATGTTTTGTGAAGACGGGG + Intergenic
1092948403 12:13477564-13477586 CTGTATTTTTGGTAGAGATGAGG - Intergenic
1092974858 12:13734970-13734992 GTGTATGTTGGCATAAGGTGGGG + Intronic
1094649470 12:32361378-32361400 TTGTATGTTTGGTGGAGATGGGG - Intronic
1095154836 12:38839912-38839934 TTACATGTTTGGATAAGTTGGGG + Exonic
1096150467 12:49307222-49307244 CTGTATGTTTTGTAGAGATGGGG - Intergenic
1096806570 12:54144538-54144560 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1097205420 12:57316917-57316939 CTGTATTTTTGGTAGAGATGGGG + Intronic
1097851217 12:64412197-64412219 CTGTATGTTTGGTGGAGACGGGG + Intronic
1098111986 12:67132582-67132604 CTGTATTTTTGGTAGAGATGGGG + Intergenic
1098188900 12:67926888-67926910 TTGTATTTTTGGTTGAGATGGGG + Intergenic
1098891382 12:76013183-76013205 CTTTATGTTTTGTAAAGATGGGG - Intergenic
1098911267 12:76211403-76211425 TTGTATTTTTGGAAGAGATGGGG - Intergenic
1098938483 12:76507645-76507667 TTGTATTTTTGGAAGAGATGGGG - Intronic
1099809819 12:87566965-87566987 TTGTATTTTTAGAAAAGATGGGG - Intergenic
1100722389 12:97372697-97372719 TTGTATGTTTGGTAGAGATGGGG - Intergenic
1100723596 12:97385354-97385376 CAGTCTGTGTGGTTAAGATGAGG - Intergenic
1100882805 12:99037340-99037362 CTGTATTTTTAGTCAAGATGGGG - Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1102496749 12:113324874-113324896 TTGTATTTTTGGTAAAGATGAGG + Intronic
1102696811 12:114806456-114806478 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1103445399 12:120991419-120991441 TTGTATTTTTAGTTAAGATGGGG - Intronic
1103662756 12:122534665-122534687 CTGTATCTTTGGATTTAATGAGG - Exonic
1103783792 12:123417124-123417146 TTGTATTTTTGGTAAAGATGGGG - Intronic
1103822236 12:123708163-123708185 CTGTATTTTTGGTAAAGACGGGG + Exonic
1104353270 12:128063416-128063438 TTGTATTTTTGGTTGAGATGGGG + Intergenic
1105341922 13:19535029-19535051 CTGTATTTTTGGTAGAGATGGGG - Intronic
1105570342 13:21596594-21596616 TTGTATTTTTGGTAAAGATGGGG + Intronic
1105972655 13:25444816-25444838 TTGTATTTTTAGTTAAGATGGGG + Intronic
1107812989 13:44217995-44218017 CTGTATTTTTAGTTGAGATGGGG - Intergenic
1107853147 13:44590973-44590995 TTGTATTTTTGGTTGAGATGGGG + Intergenic
1109655089 13:65379899-65379921 CTGTATTTTTAGTAAAGATGAGG + Intergenic
1110414194 13:75234432-75234454 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1110944703 13:81397614-81397636 CTGTATTTTTAGTAAAGATGGGG - Intergenic
1111068752 13:83134268-83134290 CTGTATGTTTAGTAGAGATGGGG - Intergenic
1111094437 13:83493979-83494001 ATGTTTGTTTGTATAAGATGAGG + Intergenic
1111251993 13:85613489-85613511 TTGTATGTTTGGTAAAGATAGGG - Intergenic
1111936511 13:94563396-94563418 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1112188567 13:97151821-97151843 CTGAATGGTTGGAGAAGATATGG + Intergenic
1112299280 13:98215480-98215502 CTGTCTGTATCGATAAAATGAGG + Intronic
1112510733 13:100006850-100006872 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1113150873 13:107262240-107262262 TTGTATTTTTGGTAAAGATGGGG - Intronic
1116835290 14:49764308-49764330 CTGTATTTTTGGTAGAGATGGGG - Intergenic
1116879176 14:50147187-50147209 TTGTTTGTTTGTTTAAGATGGGG - Intronic
1117142659 14:52805525-52805547 TTGTATTTTTGGTTGAGATGGGG + Intergenic
1118497219 14:66319554-66319576 CTGTGTGTTTGTATAATATATGG - Intergenic
1118647557 14:67854459-67854481 TTGTATTTTTGGTAAAGATGGGG - Intronic
1118850418 14:69578838-69578860 TTGTATGTTTGGTAGAGATGGGG + Intergenic
1119499141 14:75108296-75108318 TTGTATGTTTAGTAAAGATGGGG + Intronic
1119505734 14:75171450-75171472 TTGTATGTTTGGTGAAGACGGGG + Intronic
1120129507 14:80788442-80788464 CTGTTTGTTTGTTTAAGGTGGGG - Intronic
1120472910 14:84949402-84949424 CTGTATTTTTAGTAAAGATGGGG + Intergenic
1122698847 14:103573340-103573362 TTGTATGTTTAGAAGAGATGGGG + Intronic
1122729458 14:103785223-103785245 TTGTTTGTTTGGTTGAGATGGGG + Intronic
1122909272 14:104819070-104819092 TTGCATGTTTGGCTGAGATGGGG - Intergenic
1123465246 15:20510276-20510298 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1123633269 15:22276663-22276685 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1123652870 15:22490753-22490775 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1123743291 15:23299619-23299641 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1124275974 15:28326255-28326277 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1124292161 15:28463198-28463220 TTGTATTTTTGGTAAAGATGAGG - Intergenic
1124306726 15:28585345-28585367 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1124612975 15:31221683-31221705 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1124615029 15:31235382-31235404 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1124797347 15:32794717-32794739 TTGAATGTTTGGATATCATGAGG + Intronic
1124933894 15:34151622-34151644 TTGTATTTTTGGTAAAGATGGGG + Intronic
1125551217 15:40546362-40546384 CTGTATTTTTTGGTGAGATGAGG + Intronic
1125810256 15:42534050-42534072 CTGTATGTTTAGTACAGATGTGG - Intronic
1126648305 15:50896868-50896890 TTGTATGTTTAGTAAAGATGGGG - Intergenic
1126748317 15:51849756-51849778 TTGTATTTTTGGAAGAGATGAGG - Intronic
1127378690 15:58408955-58408977 CTGTATTTTTGGTAGAGATGGGG - Intronic
1127474392 15:59319136-59319158 TTGTATTTTTGGTAAAGATGGGG - Intronic
1127563565 15:60164663-60164685 TTGTATCTTTGCATAAGCTGGGG - Intergenic
1127614508 15:60670380-60670402 TTGTATTTTTAGTTAAGATGGGG + Intronic
1127823133 15:62677965-62677987 CTGTATTTTTGATAAAGATGGGG + Intronic
1128507716 15:68288000-68288022 CTGTATTTTTGGTAGAGATGGGG + Intronic
1128764947 15:70245641-70245663 CTGTATGTTTCTATAAGGAGAGG + Intergenic
1129395811 15:75245489-75245511 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1130068713 15:80628583-80628605 TTGTATTTTTGGGAAAGATGGGG - Intergenic
1130290209 15:82592413-82592435 CTGTATTTTTGGTAGAGATGGGG - Intronic
1130675560 15:85948997-85949019 TTGTATTTTTGGTTGAGATGGGG - Intergenic
1130865660 15:87931237-87931259 CTGAATGTAAGGATAGGATGTGG + Intronic
1131038468 15:89241461-89241483 CTGTATGAATGGATAAAATGTGG - Intergenic
1132008201 15:98249916-98249938 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1132126635 15:99232303-99232325 CTGTATTTTTGGGAGAGATGGGG - Intronic
1132494529 16:255160-255182 TTGTATTTTTGGTAAAGATGGGG + Intronic
1133348761 16:5088112-5088134 CTGTATGTTTTGTGAAGATGGGG + Intronic
1133580747 16:7142194-7142216 CTGTATGTTTTGTAAAGATGGGG + Intronic
1134085283 16:11352833-11352855 TTGTTTGTTTGTTTAAGATGGGG + Intergenic
1135765778 16:25176732-25176754 CTGTATTTTTGGTAGAGATGGGG + Intronic
1135930595 16:26733081-26733103 CTGGATGTTTAGATAAACTGAGG - Intergenic
1136549428 16:30974832-30974854 TTGTATTTTTAGTTAAGATGGGG - Intronic
1136648593 16:31645541-31645563 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1137282576 16:46990924-46990946 CTGTATTTTTGGTAAAGATGGGG + Intergenic
1137559518 16:49493728-49493750 ATGAATGTATGGATAGGATGTGG + Intronic
1138077561 16:54057643-54057665 CTGTATTTTTGGTAGAGATGGGG + Intronic
1138159300 16:54738196-54738218 CTCAATCTTTGGATAGGATGAGG - Intergenic
1139207910 16:65046933-65046955 CTGTATTTTTAGTAAAGATGGGG - Intronic
1139890373 16:70249775-70249797 TTGTATTTTTAGAGAAGATGGGG - Exonic
1140375501 16:74442495-74442517 TTGTATTTTTGGTAAAGATGAGG + Intergenic
1140474303 16:75231255-75231277 TTGTATTTTTGGTAAAGATGGGG + Intronic
1140641309 16:76976677-76976699 CTGTATTTTTAGTAAAGATGGGG - Intergenic
1141161027 16:81629314-81629336 CAGTGTGTTTGGGGAAGATGTGG - Intronic
1141180188 16:81747360-81747382 CTGTATTTTTAGTAAAGATGGGG - Intronic
1141487551 16:84350936-84350958 CTGTATTTTTAGTAAAGATGGGG - Intergenic
1141981196 16:87551386-87551408 TTGTATGTTTGGTAAAGACGGGG - Intergenic
1142506444 17:366643-366665 TTGTATTTTTGGAGGAGATGGGG - Intronic
1143818732 17:9542184-9542206 TTGTATGTTTGGTAGAGATGAGG - Intronic
1144073326 17:11694116-11694138 CTGTGTGTTTGGGTAGCATGGGG + Intronic
1144084352 17:11795328-11795350 CAGTATGTGTGGAAAAGATGGGG - Intronic
1144309615 17:14000554-14000576 TTGTATGTTTTGTAAAGATGAGG - Intergenic
1144932429 17:18870634-18870656 CTTTATCTTTGGTAAAGATGGGG - Intronic
1145222523 17:21101173-21101195 CTGTATTTTTGGTAGAGATGGGG + Intergenic
1145815219 17:27790264-27790286 CTGTATTTTTGGTAGAGATGGGG + Intronic
1146304049 17:31716422-31716444 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1147029943 17:37625163-37625185 TTGTATTTTTGGAAGAGATGGGG + Intronic
1147205958 17:38837502-38837524 TTGTATTTTTGGTAAAGATGGGG - Intronic
1147367453 17:39968518-39968540 TTGTATTTTTGGAAGAGATGGGG + Intronic
1147490403 17:40860617-40860639 TTGTATTTTTAGTTAAGATGGGG + Intergenic
1147493626 17:40895165-40895187 CTGTATTTTTTGTAAAGATGGGG - Intergenic
1147713553 17:42488267-42488289 ATGTATGTTTGGACAAGAACAGG + Intronic
1148005745 17:44428107-44428129 TTGTATTTTTGGTAAAGATGGGG - Intronic
1148197473 17:45724819-45724841 TTGTATGTTTGGTAGAGATGGGG - Intergenic
1148978100 17:51547195-51547217 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1149821271 17:59780416-59780438 CTGTATTTTTGGTAGAGATGCGG - Intronic
1149823216 17:59800905-59800927 TTGTATTTTTAGTTAAGATGGGG - Intronic
1150591192 17:66564249-66564271 CTGTATTTTTAGTAAAGATGAGG + Intronic
1152088432 17:78233999-78234021 CTGAATATTTGGAAAGGATGGGG - Intronic
1153636924 18:7120579-7120601 TTGTATTTTTGGAAGAGATGGGG - Intergenic
1153790239 18:8572380-8572402 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1154166835 18:12021687-12021709 TTGTATGTTTGGTAGAGATGGGG + Intronic
1154277899 18:12977998-12978020 CTGTATTTTTTGTAAAGATGGGG + Intronic
1154943617 18:21138299-21138321 TTGTATTTTTGGAGGAGATGGGG - Intergenic
1154944391 18:21147450-21147472 TTGTATTTTTAGTTAAGATGGGG + Intergenic
1155521563 18:26673754-26673776 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1156254032 18:35377959-35377981 CTGTATGTTTTGTAGAGATGCGG - Intergenic
1156710833 18:39943437-39943459 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1157021167 18:43783993-43784015 TTGTATTTTTTGTTAAGATGGGG - Intergenic
1157980110 18:52369935-52369957 CTGTATGTTTGGATAAGATGAGG - Intronic
1158550421 18:58431070-58431092 CTGTGTGGTTGGAGCAGATGAGG - Intergenic
1158800563 18:60903541-60903563 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1159236908 18:65687261-65687283 CTGTATTTTTGGTAGAGATGGGG + Intergenic
1161627001 19:5332974-5332996 CTGTATTTTTGGTAGAGATGGGG - Intronic
1161755394 19:6129770-6129792 TTGTATTTTTGGTAAAGATGGGG + Intronic
1161758733 19:6154682-6154704 TTGTATTTTTGGTAAAGATGGGG + Intronic
1162221345 19:9179365-9179387 TTGTATTTTTAGATGAGATGGGG - Intergenic
1162403113 19:10457864-10457886 CTGTTTGTCTGCAGAAGATGGGG - Exonic
1162812074 19:13170229-13170251 CTGTAAATTTTGAAAAGATGGGG + Intergenic
1163038585 19:14586294-14586316 TTGTATTTTTAGAAAAGATGGGG + Intronic
1163039279 19:14590557-14590579 TTGTATTTTTAGAAAAGATGGGG + Intronic
1163454456 19:17398206-17398228 TTGTATTTTTAGTTAAGATGGGG - Intergenic
1163459375 19:17427333-17427355 CTGTATTTTTGGTAGAGATGGGG - Intronic
1163722301 19:18904135-18904157 TTGTATTTTTGGTAAAGATGGGG + Intronic
1163877896 19:19890693-19890715 CTGTATTTTTAGTTGAGATGGGG + Intronic
1164022535 19:21321413-21321435 CTGTATTTTTAGTTGAGATGGGG - Intronic
1165088904 19:33372233-33372255 CTGTATTTTTGGTAGAGATGGGG + Intergenic
1165162709 19:33827195-33827217 CTGTATTTTTAGTAAAGATGGGG + Intergenic
1165416878 19:35699906-35699928 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1165470093 19:35998331-35998353 TTGTATTTTTAGTTAAGATGGGG + Intergenic
1165669178 19:37660913-37660935 CTGTATGTTTGTATTTGTTGAGG + Intronic
1165765644 19:38349302-38349324 TTGTATTTTTGGTAAAGATGGGG + Intronic
1166311021 19:41962620-41962642 TTGTATGTTTAGTAAAGATGGGG - Intergenic
1166815047 19:45539487-45539509 CTGTATGTTTTGTAGAGATGAGG + Intronic
1167047916 19:47061993-47062015 CTGTATTTTTAGTAAAGATGGGG + Intergenic
1167757100 19:51419573-51419595 TTGTATTTTTAGAAAAGATGGGG + Intergenic
1167902922 19:52635545-52635567 TTGTATTTTTGGCAAAGATGGGG - Exonic
1167910225 19:52695815-52695837 CTGTATTTTTAGTAAAGATGGGG + Intergenic
1167918017 19:52757956-52757978 CTGTATTTTTAGTAAAGATGGGG + Intergenic
1167933638 19:52889009-52889031 TTGTATTTTTAGTTAAGATGTGG - Intronic
1168078333 19:53992331-53992353 GTGTGTGTTTGGAGGAGATGTGG - Exonic
1168090773 19:54081841-54081863 TTGTATTTTTAGTTAAGATGAGG + Intergenic
1168655806 19:58126825-58126847 CTGTATTTTTGGTAGAGATGGGG + Exonic
925990773 2:9252406-9252428 CTGTATTTTTAGTAAAGATGGGG - Intronic
926162486 2:10498692-10498714 TTGTATGTTTGGTAGAGATGAGG - Intergenic
927168148 2:20345697-20345719 TTGTATTTTTGGAAGAGATGGGG - Intronic
927704388 2:25288006-25288028 TTGTATTTTTGGTAAAGATGGGG + Intronic
927949468 2:27157605-27157627 CTGTATTTTTGGTAGAGATGGGG - Intergenic
928347383 2:30513360-30513382 CTGCATTTTTGGAAAAAATGGGG + Intronic
928627951 2:33160049-33160071 CTGTATTTTTGGTAGAGATGGGG + Intronic
929364148 2:41131497-41131519 CTGTATGTTTCCAAAACATGTGG + Intergenic
929463836 2:42127090-42127112 CTGTATTTTTAGAAGAGATGGGG + Intergenic
929483391 2:42334168-42334190 CTGTATTTTTGGTAGAGATGGGG - Intronic
931724421 2:65095205-65095227 CTGTATGTTTTGCAAAGATGAGG + Intronic
933883182 2:86692341-86692363 TTGTATTTTTGGTAAAGATGGGG - Intronic
934130494 2:88943725-88943747 CTGAATGTTGGGAGAAGCTGAGG + Intergenic
934972859 2:98776985-98777007 TTGTATTTTTAGAAAAGATGAGG + Intergenic
935505026 2:103889710-103889732 TTGTATGTTTAGTAAAGATGGGG + Intergenic
936024543 2:109021347-109021369 TTGTATGTTTAGAAGAGATGGGG - Intergenic
936580527 2:113696658-113696680 CTGTATGTTTAGTAGAGATGGGG + Intergenic
937300388 2:120835556-120835578 TTGTATTTTTAGAAAAGATGGGG + Intronic
937883956 2:126887598-126887620 CTGTATGTTTGGTAGAGACGGGG + Intergenic
937946846 2:127347027-127347049 CTGTATGTTTTGAGATGATTTGG - Intronic
938473414 2:131586663-131586685 CTGTATTTTTGGTAGAGATGAGG - Intergenic
939035624 2:137127742-137127764 CTGTATTTTTGGTAGAGATGGGG - Intronic
939321099 2:140623744-140623766 CTGTATTTTTAGAAGAGATGGGG - Intronic
940002787 2:148983448-148983470 CTGCATTCTTGGATAAGAAGGGG - Intronic
940076476 2:149747834-149747856 CTGGGTGTTTGTATAGGATGGGG - Intergenic
940113661 2:150183520-150183542 CTGTATGTTTAGTAGAGATGGGG - Intergenic
940843837 2:158618008-158618030 CTGTATTTTTAGTAAAGATGGGG - Intronic
941312615 2:163952922-163952944 TTGTATTTTTGGTAAAGATGGGG + Intergenic
941676006 2:168344207-168344229 CTGTATTTTTAGTAAAGATGGGG - Intergenic
941824687 2:169881349-169881371 TTGTATTTTTGGTAAAGATGGGG + Intronic
941894579 2:170616244-170616266 CTGTCCGTATGGATAAGATAGGG - Intronic
942124855 2:172813619-172813641 CTGTCTGTCTTGACAAGATGAGG - Intronic
942272193 2:174287467-174287489 TTGTATTTTTGGTTTAGATGGGG + Intergenic
942676344 2:178430288-178430310 CCGTATGTATTGATAAAATGAGG - Intergenic
943913077 2:193592969-193592991 TTGTATTTTTGGTAAAGATGGGG - Intergenic
943992547 2:194715059-194715081 TTGTATATTAGGTTAAGATGGGG - Intergenic
944843855 2:203649458-203649480 TTGTATTTTTGGCAAAGATGAGG - Intergenic
944952999 2:204774552-204774574 CTGTATTTATGGATAACATTAGG + Intronic
945086663 2:206138942-206138964 CTGTATTTTTAGAAGAGATGGGG - Intronic
945511743 2:210711732-210711754 CTGTCTCTTTGGAAAATATGTGG + Intergenic
946263188 2:218513989-218514011 CTGTATTTTTGGTAGAGATGAGG + Intronic
946523551 2:220493247-220493269 CTGTATGTATCAATAAGAGGAGG + Intergenic
946733627 2:222732798-222732820 CAGTTTGTTTGGATAATATCTGG + Intergenic
947234390 2:227924631-227924653 CTGTATTTTTGGTAGAGATGGGG - Intergenic
1169314759 20:4580843-4580865 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1169401994 20:5289974-5289996 TTGTATTTTTGGTTGAGATGGGG - Intergenic
1169632754 20:7651189-7651211 CTGTAATTGTGGAGAAGATGGGG - Intergenic
1170000643 20:11609607-11609629 ATGCATGTTTGGAGAACATGGGG - Intergenic
1170221122 20:13942778-13942800 ATGTATGTTTGAAAAAAATGGGG + Intronic
1170682709 20:18540681-18540703 CTGTATTTTTGGTAGAGATGAGG - Intronic
1170954565 20:20967079-20967101 ATGTTTGCTTGAATAAGATGGGG + Intergenic
1171461239 20:25299222-25299244 TTGTATGTTTTGTAAAGATGGGG - Intronic
1172225191 20:33300758-33300780 CTGTATTTTTTGTAAAGATGGGG + Intronic
1172374655 20:34427808-34427830 CTGTATCTTTGTATAATAAGTGG + Intronic
1172524118 20:35587314-35587336 CTGTATTTTTAGTAAAGATGGGG - Intergenic
1172730137 20:37080327-37080349 TTGTATTTTTGGTAAAGATGGGG + Intronic
1173058657 20:39640521-39640543 TTGTATTTTTAGACAAGATGGGG - Intergenic
1173090763 20:39968883-39968905 CTGTTTCTCTGGGTAAGATGTGG - Intergenic
1173654227 20:44688751-44688773 TTGTATTTTTAGTTAAGATGGGG - Intergenic
1174311844 20:49662250-49662272 TTGTATGTTTGCATATGTTGGGG - Intronic
1176985620 21:15432196-15432218 CTGTATGCTTGCATGAGAAGAGG - Intergenic
1177160760 21:17545602-17545624 TTGTATTTTTGGTAAAGATGGGG + Intronic
1177311418 21:19399787-19399809 CTGAATGTCTGTAGAAGATGCGG + Intergenic
1177623659 21:23630507-23630529 CTTTATGTTTAGATTATATGGGG + Intergenic
1178846741 21:36180394-36180416 TTGTATTTTTGGTAAAGATGAGG - Intronic
1178858596 21:36270739-36270761 TTGTATTTTTAGTTAAGATGGGG - Intronic
1178868499 21:36351239-36351261 CTGTATTTTTGGTAGAGATGGGG + Intronic
1179651709 21:42814484-42814506 CTGTATTTTTGGTAGAGATGGGG - Intergenic
1179834586 21:44021755-44021777 CTTTATTATTGGATTAGATGAGG + Intronic
1180253799 21:46607911-46607933 CAGTATTTCTGGATAAGAAGGGG - Intergenic
1181144160 22:20832287-20832309 TTGTATTTTTGGTAAAGATGGGG + Intronic
1182624302 22:31634663-31634685 TTGTATGTTTAGTAAAGATGGGG - Intronic
1184259917 22:43308823-43308845 CTGTCTGTTAGGATCAGTTGAGG - Intronic
1184278443 22:43423972-43423994 CTGTGTGTTGGGGTAGGATGGGG + Intronic
1185092563 22:48784215-48784237 CTGGATTTTTGGAAAAGATGGGG + Intronic
949124936 3:435789-435811 GTGTAGGTTTGGAGAAGAGGAGG - Intergenic
949288338 3:2432993-2433015 TTGTTTGTTTAGTTAAGATGGGG + Intronic
949352614 3:3139899-3139921 TTGTATGTTTGGTAGAGATGGGG + Intronic
952023307 3:29048915-29048937 CTTTTTCTTTGGCTAAGATGGGG - Intergenic
952944415 3:38468050-38468072 TTGTATTTTTGGAAGAGATGGGG + Intronic
953174086 3:40533311-40533333 CTGTATTTTTAGAAGAGATGGGG + Exonic
953924300 3:46974107-46974129 CTGTATGATTTGATTACATGAGG + Intronic
954311155 3:49768595-49768617 TTGTATTTTTGGTAAAGATGGGG - Intronic
954420618 3:50417253-50417275 CTGTATGTATGGCTAAGGTGTGG - Intronic
955668475 3:61376139-61376161 CTGTATTTTTAGTAAAGATGGGG - Intergenic
955799851 3:62674851-62674873 TTGTATGTTTGGTGAAGCTGAGG + Intronic
956232685 3:67034890-67034912 ATGTGTGTCTGTATAAGATGCGG - Intergenic
956380915 3:68663617-68663639 GTGTATGTATGTATGAGATGGGG - Intergenic
956527271 3:70178834-70178856 TTGTATTTTTGGTAAAGATGAGG - Intergenic
959710493 3:109381097-109381119 CTGTATTTTTGGTAGAGATGGGG + Intergenic
959928522 3:111953160-111953182 TTGTATGTATGGATAAACTGAGG + Intronic
960260577 3:115563581-115563603 CTGTATGTTGGGAAGAGAAGGGG + Intergenic
960309016 3:116097905-116097927 TTGTATTTTTAGGTAAGATGGGG + Intronic
960402560 3:117220311-117220333 CAGTATAGTTGGATAAGCTGTGG - Intergenic
960405212 3:117251660-117251682 CTGTACGTTTGGAGAAGGAGTGG + Intergenic
961301729 3:125926082-125926104 CTGTATGTTTTGTGGAGATGGGG - Intergenic
961886734 3:130101770-130101792 CTGTATGTTTTGTGAAGATGGGG + Intronic
962170498 3:133096565-133096587 TTGTGTGTTTGGATGAGGTGAGG - Intronic
962244431 3:133780046-133780068 CTGTATTTGAGTATAAGATGAGG - Intergenic
963402258 3:144814295-144814317 ATATCTGTTTGGATAAAATGCGG - Intergenic
964748558 3:160033915-160033937 CCGTATGTCAGGAAAAGATGAGG + Intergenic
965365353 3:167791950-167791972 CTGTATTTTTAGAAGAGATGGGG - Intronic
965543410 3:169892163-169892185 CTGTATGTTTAGTAGAGATGGGG - Intergenic
965573522 3:170195063-170195085 CTGTATTTTTGGTAGAGATGGGG - Intergenic
965760321 3:172068595-172068617 TTGTATTTTTGGAAGAGATGGGG + Intronic
966710479 3:182967200-182967222 CTGTCTGTTTGGGCCAGATGAGG - Intronic
967636914 3:191812866-191812888 TCTTATATTTGGATAAGATGGGG - Intergenic
967696230 3:192534562-192534584 TTGTATTTTTAGAAAAGATGGGG + Intronic
968177795 3:196566584-196566606 TTGTATGTTTGGTAGAGATGGGG + Intronic
968264227 3:197350205-197350227 TTGTATGTTTAGAAGAGATGGGG + Intergenic
969758083 4:9162924-9162946 CTGTATGTTTTGTGAAGATGGGG - Intergenic
969761236 4:9184211-9184233 TTGTATTTTTGGTAAAGATGGGG - Intergenic
969818054 4:9700466-9700488 CTGTATGTTTTGTGGAGATGGGG - Intergenic
969863899 4:10060187-10060209 CTGTATTTTTGGTAGAGATGAGG - Intergenic
970526497 4:16937804-16937826 CTGTATTTTTGGTAGAGATGGGG - Intergenic
970713303 4:18889762-18889784 CTGTATTTTTGGTGGAGATGGGG - Intergenic
971171765 4:24240937-24240959 TTGTATCTTTGGATGAGAGGGGG - Intergenic
971382210 4:26109276-26109298 CTGTATTTTTAGAAGAGATGGGG + Intergenic
971562898 4:28104058-28104080 TTGTATTTTTGGTAAAGATGGGG - Intergenic
971817795 4:31511220-31511242 ATGTATGTTTGGAAAAGATTAGG + Intergenic
971864528 4:32152224-32152246 TTGTATTTTTGGTAAAGATGGGG + Intergenic
972620036 4:40738447-40738469 CTGTATTTTTAGTAAAGATGGGG + Intergenic
973747660 4:53980252-53980274 TTGTATTTTTGGCAAAGATGGGG - Intronic
973749009 4:53993989-53994011 CTGTATGATTGGAAAATATGGGG - Intronic
974000629 4:56507485-56507507 CTGTATTTTTGGTAGAGATGGGG + Intronic
974219101 4:58942826-58942848 GAGTATGTTTGGATATGATAGGG + Intergenic
975542048 4:75523629-75523651 TTGTATTTTTGGTAAAGATGGGG - Intronic
976324462 4:83755115-83755137 ATGTAAGTTTGGATGAGTTGGGG - Intergenic
976393065 4:84525685-84525707 CTGTATGTTTAGTTAAGACGGGG - Intergenic
977459004 4:97300471-97300493 TTGTCTTGTTGGATAAGATGGGG - Intronic
977981086 4:103322873-103322895 CAGTATGTTGGGATAGAATGCGG - Intergenic
978303872 4:107300689-107300711 GTGTATTTTTGGTAAAGATGGGG - Intergenic
978532809 4:109731170-109731192 CTGTATTTTTGGTAGAGATGGGG - Intergenic
979892219 4:126112548-126112570 CTGTATTTTTAGTAAAGATGGGG + Intergenic
980021210 4:127712449-127712471 CTCAATGTTTAAATAAGATGGGG - Intronic
980921404 4:139089890-139089912 CTGTTTGTTGGTATATGATGTGG - Intronic
981536584 4:145806326-145806348 TTGTATTTTTGGTAAAGATGGGG + Intronic
981925243 4:150132040-150132062 CTGTGTGTGAGGATAAGCTGTGG + Intronic
983073152 4:163293145-163293167 TTGTATTTTTGGTAAAGATGAGG - Intergenic
983130130 4:164008571-164008593 TTGTATTTTTGCCTAAGATGTGG - Intronic
983193723 4:164782116-164782138 CTGTATTTTTGGTAGAGATGGGG - Intergenic
983328835 4:166297036-166297058 TTGTATTTTTTGTTAAGATGAGG + Intergenic
984311287 4:178063407-178063429 GTGTATGTTTGGTTAATATGGGG - Intergenic
984355045 4:178647168-178647190 CTGAATGTTGGGAGAAGCTGAGG - Intergenic
985285078 4:188329054-188329076 CTGTATTTTTCCATAAGATAAGG + Intergenic
985346802 4:189014452-189014474 TTGTATTTTTGGTTGAGATGGGG + Intergenic
985812759 5:2102275-2102297 TTGTATTTTTGGTAAAGATGAGG + Intergenic
987382584 5:17299608-17299630 TTGTATTTTTGGTAAAGATGGGG - Intergenic
987469777 5:18312775-18312797 TTGTATTTTTGGAAGAGATGGGG - Intergenic
987920751 5:24277205-24277227 CAGAACGTTTGGATAAGAAGTGG + Intergenic
988651900 5:33161902-33161924 TTGTATGTTTTGTAAAGATGAGG + Intergenic
989060570 5:37407348-37407370 TTGTATTTTTGGTAAAGATGGGG - Intronic
989094027 5:37764570-37764592 TTGTATTTTTGGTAAAGATGGGG - Intergenic
989487189 5:42005064-42005086 CTGAAAGTTTGGAGATGATGAGG - Intergenic
989742283 5:44787749-44787771 CTGAATGTTTGAACAAGTTGTGG - Intergenic
989977814 5:50607638-50607660 CTGTATTTTTGGAGGAGACGGGG + Intergenic
990572217 5:57090386-57090408 TTGTATTTTTGGTTGAGATGGGG - Intergenic
991350271 5:65713853-65713875 TTGTATTTTTGGTAAAGATGGGG - Intronic
991903950 5:71488878-71488900 CTGTATTTTTGGTAGAGATGGGG + Intronic
993128722 5:83869042-83869064 TTGTATTTTTGGAAGAGATGGGG - Intergenic
993357270 5:86929964-86929986 TTGTATTTTTAGTTAAGATGGGG - Intergenic
994097883 5:95863416-95863438 CTGTGTGTTTCGATTTGATGTGG + Intergenic
994431965 5:99677864-99677886 TTGTATTTTTGGTAAAGATGTGG - Intergenic
994722486 5:103396609-103396631 CTGGATGCTTGGATAAGCCGAGG + Intergenic
994759847 5:103838027-103838049 CTGTTTGTTTGTTTAAGATATGG - Intergenic
995201891 5:109434486-109434508 TTGTATTTTTGGTAAAGATGGGG - Intergenic
995972152 5:117985515-117985537 CTGTATTTTTAGTAAAGATGGGG + Intergenic
996848556 5:127928098-127928120 CTGTATGTTTAGTAGAGATGGGG + Intergenic
997290921 5:132734356-132734378 CTGTCAGTGTGGATGAGATGAGG - Exonic
997708430 5:135981270-135981292 TTGTATGTTTTGTTGAGATGGGG + Intergenic
998391875 5:141792455-141792477 TTGTATTTTTGGTAAAGATGGGG - Intergenic
999157407 5:149468237-149468259 TTGTATTTTTGGAAGAGATGGGG - Intergenic
999974713 5:156899886-156899908 TTGTATCTTTGGAAGAGATGGGG - Intergenic
1000651661 5:163825676-163825698 CTGGAGGTTTGGCTAAGTTGGGG + Intergenic
1001484833 5:172112045-172112067 CTGAATGGTTAGATAAGTTGTGG + Intronic
1001560312 5:172664926-172664948 CTATATGTTAGGATAAAATGCGG - Intronic
1001735308 5:173993466-173993488 TTGTATTTTTGGCAAAGATGGGG - Intronic
1002244561 5:177873020-177873042 TTGTATTTTTGGTTGAGATGGGG - Intergenic
1002672402 5:180878677-180878699 CTGTATTTTTGGTAGAGATGGGG + Intergenic
1002885742 6:1292359-1292381 CTGGATTTTTGGAAAAGAAGAGG - Intergenic
1004213893 6:13683001-13683023 CTGTATGTTTGTAAATGTTGGGG + Intronic
1004529428 6:16439900-16439922 TTGTATTTTTGGTAAAGATGGGG - Intronic
1005126226 6:22449776-22449798 TTGTATTTTTAGAAAAGATGGGG + Intergenic
1007087240 6:39157332-39157354 CTCTCTGTTTCGAGAAGATGAGG - Intergenic
1007142718 6:39591936-39591958 TTGTATTTTTGGTAAAGATGGGG - Intronic
1007376358 6:41459548-41459570 CTGTATCTTTAGTAAAGATGGGG - Intergenic
1007572999 6:42906791-42906813 CTGTATTTTTAGTTGAGATGGGG - Intergenic
1007831279 6:44640336-44640358 CTTTATGTTTGTATAACATTTGG + Intergenic
1009584242 6:65576539-65576561 CTCTATTTTTGAATAAAATGGGG - Intronic
1009772523 6:68161379-68161401 CTGTGTGACTGGAAAAGATGTGG + Intergenic
1010719852 6:79270706-79270728 CTGTATTTTTGGTAGAGATGGGG - Intergenic
1010748999 6:79597055-79597077 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1011047859 6:83106635-83106657 TTGTATTTTTAGTTAAGATGAGG - Intronic
1011281967 6:85686681-85686703 TTGTATGTTTAGTAAAGATGGGG - Intergenic
1011490655 6:87887979-87888001 CTATATTTTTGGTGAAGATGGGG - Intergenic
1011793674 6:90928577-90928599 CCTAATGTTTGGATAATATGTGG + Intergenic
1012266703 6:97153541-97153563 TTGTATTTTTAGAAAAGATGTGG + Intronic
1013172017 6:107645279-107645301 CCCTCTGTTTGGATATGATGAGG - Intronic
1013436465 6:110114917-110114939 CTGTATTTTTGGTTGAGACGGGG - Intronic
1013520970 6:110933359-110933381 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1013560336 6:111297159-111297181 TTGTATTTTTGGTTGAGATGGGG - Intergenic
1015010796 6:128344687-128344709 TTGTATTTTTGGAAAAGATGGGG + Intronic
1017081713 6:150675657-150675679 CTGTATTTTTGGTAGAGATGGGG + Intronic
1018764007 6:166915670-166915692 CTGTCCATTTGGATAAGATAGGG - Intronic
1018991960 6:168680997-168681019 CTGTATTTTTGGTAGAGATGGGG + Intergenic
1019995816 7:4723840-4723862 TTGTATTTTTGGTAAAGATGGGG + Intronic
1020058574 7:5135594-5135616 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1020230408 7:6314136-6314158 CTGTATGTTTAGTACAGATGGGG + Intergenic
1020950533 7:14670474-14670496 TTGTATGTTTAGTTGAGATGGGG + Intronic
1021114096 7:16729206-16729228 CTGTATTTTTAGAAGAGATGGGG - Intergenic
1021710690 7:23413030-23413052 CTGTATTTTTAGTTAAGATGGGG + Intronic
1021763891 7:23927838-23927860 GTGTATGTTTGCATAATGTGGGG - Intergenic
1022984083 7:35633239-35633261 TTGTATTTTTAGTTAAGATGGGG + Exonic
1022991481 7:35712530-35712552 TTGTATTTTTGGTTGAGATGGGG - Intergenic
1023471636 7:40528669-40528691 CTGTATATTTGGATTTGATGTGG + Intronic
1023708829 7:42970246-42970268 TTGTATTTTTGGTGAAGATGGGG + Intergenic
1025000882 7:55313628-55313650 TTGTATTTTTGGAAGAGATGGGG - Intergenic
1025238485 7:57251523-57251545 CTGTATGTTTAGTAGAGATGGGG + Intergenic
1025803097 7:64806117-64806139 CTGTATGTTTATATTATATGTGG - Intronic
1026822621 7:73559585-73559607 CTGTATGTTTAGTAGAGATGGGG - Intergenic
1027003159 7:74668744-74668766 TTGTATTTTTAGAAAAGATGGGG + Intronic
1027623235 7:80518561-80518583 TTGTATGTTTGGTAGAGATGGGG + Intronic
1028476464 7:91258622-91258644 CTCTCTGATTGGCTAAGATGTGG - Intergenic
1028802196 7:94978967-94978989 TTGTATTTTTGGTAAAGATGGGG + Intronic
1029383046 7:100225778-100225800 TTGTATTTTTGGTAAAGATGGGG + Intronic
1029416759 7:100448014-100448036 CTGTATTTTTGGAAGAGATGGGG - Intergenic
1030081412 7:105782003-105782025 TTGTATTTTTGGTAAAGATGGGG + Intronic
1031356957 7:120798665-120798687 CTGTATGTCCTGATAATATGTGG - Intronic
1032184939 7:129716696-129716718 TTGTATTTTTGGTAAAGATGGGG - Intronic
1032916716 7:136498431-136498453 GTGTATGAATGGATAAGATGTGG - Intergenic
1033086816 7:138350394-138350416 TTGTATTTTTAGTTAAGATGGGG - Intergenic
1033661378 7:143405455-143405477 GTGTGTGTTTTGAAAAGATGGGG + Intronic
1033902086 7:146155874-146155896 TTGTATTTTTAGTTAAGATGGGG + Intronic
1033932346 7:146539656-146539678 CTGTAGATTTAGATAAGATGAGG + Intronic
1034185653 7:149174650-149174672 TTGTATTTTTGGTAAAGATGGGG - Intronic
1034256402 7:149726991-149727013 CTGTATGTTTTCCTAAGTTGGGG - Intronic
1034693603 7:153034582-153034604 CTGTATTTTTAGTTGAGATGAGG + Intergenic
1034750809 7:153567256-153567278 CTATAAGTTTTGATAAGTTGTGG + Intergenic
1036271335 8:7306043-7306065 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1036350014 8:8004300-8004322 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1036848227 8:12184382-12184404 CTGTATGTTTTGTGAAGATGGGG + Intronic
1036869589 8:12426663-12426685 CTGTATGTTTTGTGAAGATGGGG + Intronic
1038652958 8:29422232-29422254 GTGTATGTTTAGAAGAGATGGGG - Intergenic
1038700990 8:29849184-29849206 CTGGATGTTTGGTGAAGACGGGG - Intergenic
1038728698 8:30106338-30106360 CTGTATGTCTGCATAACATTGGG - Intronic
1039898379 8:41732583-41732605 TTGTATGTTTAGTAAAGATGGGG + Intronic
1040639513 8:49316953-49316975 TTGTATTTTTGGTTGAGATGGGG + Intergenic
1041077790 8:54185049-54185071 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1041616633 8:59915142-59915164 CTGTATGTTTAGTAGAGATGGGG - Intergenic
1042150964 8:65783429-65783451 CTGTATATTTGGTGTAGATGAGG - Intronic
1042291236 8:67171224-67171246 CTGTATTTTTAGTAAAGATGGGG - Intronic
1042451863 8:68956816-68956838 TTGTATTTTTAGAAAAGATGGGG + Intergenic
1044293160 8:90496494-90496516 CTCTATGTTTCCATGAGATGAGG + Intergenic
1044325893 8:90857230-90857252 CTGTATGTTTGGGTAACATAAGG + Intronic
1045768751 8:105708614-105708636 TTGTATTTTTGGTTGAGATGAGG + Intronic
1045891127 8:107158955-107158977 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1046062633 8:109157461-109157483 TTGTATTTTTAGATGAGATGGGG - Intergenic
1046170573 8:110499802-110499824 CTGTATTTTTGGTTGAGACGGGG + Intergenic
1046608500 8:116397104-116397126 CTGTAAGTCTGGAATAGATGAGG - Intergenic
1046650954 8:116836044-116836066 CTGTATGCTTTCCTAAGATGTGG - Intronic
1046830345 8:118738705-118738727 CTATGTGTTTGGAGAAGATTCGG - Intergenic
1047162933 8:122401558-122401580 CTGTTTGTTTGGACCAAATGTGG + Intergenic
1047326789 8:123846899-123846921 CTGTATTTTTAGAGAAGACGGGG - Intergenic
1047327429 8:123853325-123853347 CTGTATTTTTAGAGAAGACGGGG + Intronic
1047421227 8:124709941-124709963 CTGTATGATGTGATAAGTTGGGG - Intronic
1049064913 8:140305472-140305494 TTGTATTTTTGGAAGAGATGGGG + Intronic
1049122154 8:140748319-140748341 CTGTATTTTTAGTAAAGATGGGG - Intronic
1049464156 8:142743572-142743594 ATGTATGGGTGGATAAGTTGGGG + Intergenic
1049511735 8:143030617-143030639 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1049607191 8:143535209-143535231 TTGTATTTTTGGTAAAGATGGGG + Intronic
1050372678 9:4937596-4937618 CTGTATATTTGGATTGTATGGGG - Intergenic
1051031388 9:12684388-12684410 TTGTATTTTTGGTCAAGATGGGG + Intergenic
1051296486 9:15601372-15601394 CTGAAGGTTTGGAAAAGCTGTGG - Intronic
1051659582 9:19413424-19413446 TTGTATTTTTGGTAAAGATGGGG - Intronic
1052430072 9:28354253-28354275 CAGTAGGTTTGGGAAAGATGAGG + Intronic
1052740563 9:32388354-32388376 CTGTATTTTTGGTAGAGATGGGG - Intronic
1053082048 9:35184533-35184555 TTGTATGTTTGGAGGAGACGGGG - Intronic
1053243115 9:36513016-36513038 CTGTATTTTTTGTAAAGATGGGG - Intergenic
1053525859 9:38829919-38829941 TTGTATGTTTGGTAGAGATGGGG + Intergenic
1053754307 9:41288342-41288364 TTGTATGTTTGGTTGAGACGGGG + Intergenic
1054259824 9:62852681-62852703 TTGTATGTTTGGTTGAGACGGGG + Intergenic
1054331944 9:63767331-63767353 TTGTATGTTTGGTTGAGACGGGG - Intergenic
1055520066 9:77071742-77071764 CTGTATTTTTAGTAAAGATGGGG + Intergenic
1056886149 9:90445939-90445961 TTGTATTTTTGGAAGAGATGGGG + Intergenic
1057166319 9:92929619-92929641 TTGTATTTTTAGAAAAGATGGGG + Intergenic
1057344835 9:94240397-94240419 TTGTATTTTTGGTTAAGATGGGG - Intergenic
1058083796 9:100727255-100727277 TTGTATTTTTAGAAAAGATGGGG - Intergenic
1058099571 9:100904256-100904278 TTGTATGTTTAGTTGAGATGGGG - Intergenic
1058297924 9:103332282-103332304 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1058848636 9:108988254-108988276 CTGTATTTTTAGAAGAGATGGGG + Intronic
1058903866 9:109465401-109465423 TTGTATGTTTGGTACAGATGAGG - Intronic
1059106174 9:111513602-111513624 TTGTATTTTTGGTAAAGATGGGG - Intergenic
1059151191 9:111951080-111951102 CTGTCTATTTGGAGAAGTTGAGG - Intergenic
1059168413 9:112100657-112100679 TTGTATTTTTGGTAAAGATGGGG - Intronic
1059425421 9:114217939-114217961 TTGTATTTTTGGTAAAGATGGGG - Intronic
1060088614 9:120723025-120723047 CTGTATTTTTGGTAGAGATGGGG - Intergenic
1060261090 9:122074098-122074120 TTGTATATTTGGTAAAGATGGGG - Intronic
1060754417 9:126202418-126202440 TTGTATTTTTGGAAGAGATGAGG - Intergenic
1060956333 9:127643511-127643533 TTGTATTTTTGGTAAAGATGGGG + Intronic
1060980863 9:127790956-127790978 TTGTATGTTTAGTAAAGATGGGG + Intergenic
1061163702 9:128910518-128910540 CTGTATTTTTGGTAGAGATGGGG - Intronic
1061430996 9:130530978-130531000 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1062314254 9:135958219-135958241 CTGTATTTTTAGTAAAGATGGGG + Intronic
1062604541 9:137340302-137340324 TTGTATGTTTGGTAGAGATGAGG - Intronic
1202799325 9_KI270719v1_random:160455-160477 TTGTATGTTTGGTTGAGACGGGG - Intergenic
1185541886 X:908791-908813 TTGTATCTTTAGAAAAGATGGGG + Intergenic
1186473738 X:9841126-9841148 TTGTATGTTTGGTAGAGATGGGG + Intronic
1186761333 X:12725670-12725692 CTAAATGTTTGGAAAAGATAAGG - Intergenic
1186829413 X:13375861-13375883 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1188622378 X:32241789-32241811 CTGTATTTTGGGAGCAGATGAGG + Intronic
1189017325 X:37297756-37297778 CTGTCTGTATGGATAAGATAGGG - Intergenic
1189124646 X:38433541-38433563 GTGTATGTAAGGATAAGATATGG + Intronic
1189534268 X:41921463-41921485 CTGTATGTTTTTATTAAATGTGG + Intronic
1189643399 X:43099158-43099180 CTGTATTTTTGGTAGAGATGGGG - Intergenic
1189742068 X:44129338-44129360 CTGTATTTTTAGAAGAGATGGGG - Intergenic
1190513574 X:51199164-51199186 TTGTATTTTTGGTAAAGATGGGG + Intergenic
1190533293 X:51402479-51402501 GTGTATTTTTGGTAAAGATGGGG - Intergenic
1191269524 X:58445453-58445475 CTGTCCTTATGGATAAGATGGGG - Intergenic
1192373514 X:70535572-70535594 TTGTATGTTTGGTAGAGATGCGG - Intronic
1194721076 X:97340826-97340848 TTGTATTTTTAGAAAAGATGGGG + Intronic
1195387724 X:104328916-104328938 TTGTATGTTTGGTAGAGATGGGG - Intergenic
1195584925 X:106553801-106553823 TTGTATGTTTAGTAAAGATGAGG - Intergenic
1197819211 X:130529116-130529138 TTCTATGTTTGCAGAAGATGGGG - Intergenic
1198331127 X:135623828-135623850 TTGTATGTTTTGCTGAGATGTGG - Intergenic
1198674637 X:139118984-139119006 CTCTATGTTTTGTAAAGATGGGG - Intronic
1198732549 X:139747934-139747956 CTTTATTTTTGCATCAGATGTGG + Intronic
1200049703 X:153422267-153422289 CTGAATGTTGGCATAGGATGGGG + Intergenic
1200086293 X:153608407-153608429 GTGTCTGTTTGGAGAGGATGTGG + Intergenic
1201466015 Y:14282188-14282210 CTGGATGTTTGGAAGAAATGGGG - Intergenic
1201482667 Y:14456826-14456848 CTGTATGTTTAGTAGAGATGGGG - Intergenic
1202301100 Y:23415243-23415265 CTGTATTTTTAGTAAAGATGGGG + Intergenic
1202569711 Y:26255355-26255377 CTGTATTTTTAGTAAAGATGGGG - Intergenic
1202590388 Y:26476588-26476610 CTGTATTTTTGGTTGAGATGGGG + Intergenic