ID: 1157980326

View in Genome Browser
Species Human (GRCh38)
Location 18:52372368-52372390
Sequence CCTCATAACCAGCCAATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157980326_1157980328 -10 Left 1157980326 18:52372368-52372390 CCATGCATTGGCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1157980328 18:52372381-52372403 GGTTATGAGGACAGTGCTGTAGG 0: 1
1: 0
2: 2
3: 13
4: 188
1157980326_1157980331 25 Left 1157980326 18:52372368-52372390 CCATGCATTGGCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1157980331 18:52372416-52372438 ACAAGGCACTCCCTGTACACTGG 0: 1
1: 0
2: 0
3: 14
4: 102
1157980326_1157980329 8 Left 1157980326 18:52372368-52372390 CCATGCATTGGCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1157980329 18:52372399-52372421 GTAGGCTAAACTGTTCCACAAGG 0: 1
1: 0
2: 0
3: 1
4: 79
1157980326_1157980332 26 Left 1157980326 18:52372368-52372390 CCATGCATTGGCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1157980332 18:52372417-52372439 CAAGGCACTCCCTGTACACTGGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157980326 Original CRISPR CCTCATAACCAGCCAATGCA TGG (reversed) Intronic
902265310 1:15259219-15259241 CCTCATAACTAGTCTATACATGG - Intronic
902290233 1:15430524-15430546 CCTTGCAACCAGCCCATGCAAGG + Intergenic
904901470 1:33861059-33861081 CCTCATAACAAGCCTATGGGAGG - Intronic
906644062 1:47460451-47460473 CCTCATAACAAGCCTATGGGGGG + Intergenic
909674597 1:78225284-78225306 CCTCATGACCAGGAAATCCAGGG - Intergenic
909994151 1:82258650-82258672 CACCACAACCAGCCAATGCCTGG - Intergenic
913997288 1:143661784-143661806 CTTCAGAATCACCCAATGCACGG + Intergenic
921644451 1:217597512-217597534 CCTCTTAAACAGGCAATTCATGG + Intronic
1062847980 10:722574-722596 CCCCATAAGCAGCCCATGTAGGG - Intergenic
1065349563 10:24783269-24783291 CCTCATTACCAGGCACAGCAGGG + Intergenic
1067656687 10:48197785-48197807 TTTCATAACCAGCCAGAGCATGG - Intronic
1076691994 10:132228566-132228588 CCGCACAACCAGCCACTGCTTGG - Intronic
1080923736 11:36734210-36734232 CCTCAAAACCAGCAAATACAGGG + Intergenic
1083654695 11:64223938-64223960 CTTCATCACCAGCCAAGGAAAGG + Exonic
1085473189 11:76771270-76771292 CCTCAAAACCAGGCCATGAAGGG - Intergenic
1088336725 11:108713637-108713659 CATCATAACCAGACATGGCAGGG - Intronic
1089160984 11:116437138-116437160 CCTCATAACAAGCAGAGGCAGGG - Intergenic
1090878225 11:130810412-130810434 GCTCATGACTAGCCAATGCCTGG - Intergenic
1094493453 12:30975555-30975577 CCTCTGAACCAGCCTGTGCAGGG + Intronic
1100587297 12:95992145-95992167 CCTCATATCCTGCCACTACATGG + Intronic
1101089801 12:101273665-101273687 CCTCATAACCACCCCATGAGGGG + Intergenic
1101649765 12:106666888-106666910 GCTCAGAACCAGACAAGGCAAGG - Intronic
1103506728 12:121446030-121446052 CCTCAGCACCAGGCAAGGCAAGG + Intronic
1104583724 12:130030420-130030442 CCACAGAACCAGGCAAGGCAGGG + Intergenic
1107153776 13:37142575-37142597 CATCATATCCAGGCAAGGCAGGG - Intergenic
1113675563 13:112204682-112204704 CATAATAAACAGGCAATGCACGG - Intergenic
1119719501 14:76881753-76881775 CCTGCTACCCAGCCCATGCAGGG + Intergenic
1119895043 14:78213049-78213071 CCTCAAAATCAGCCAAACCAGGG - Intergenic
1122723233 14:103734144-103734166 CCTCACAGCCAGCCCAGGCAGGG + Exonic
1122841619 14:104467298-104467320 ACTCAGAACCAGCGAATGAAGGG - Intergenic
1123495111 15:20816522-20816544 CCTCACTCCCACCCAATGCAGGG - Intergenic
1123551603 15:21385615-21385637 CCTCACTCCCACCCAATGCAGGG - Intergenic
1127536838 15:59898007-59898029 TCTGATAACCATCCAATTCATGG - Intergenic
1130017162 15:80196479-80196501 CCTCATGACCAGCCACAGAAGGG + Intergenic
1130220727 15:82017331-82017353 CCTCATAACTAGCCTGTGAAAGG + Intergenic
1131968724 15:97871617-97871639 CCTCATCCCCCACCAATGCAGGG + Intergenic
1202959945 15_KI270727v1_random:112857-112879 CCTCACTCCCACCCAATGCAGGG - Intergenic
1134102166 16:11460116-11460138 CCTCATAGCCACCCACTCCAGGG + Intronic
1137538466 16:49345257-49345279 CCTCATTATCAGCTAATGCATGG - Intergenic
1138649616 16:58451829-58451851 CATCATAACCAGCCACTGTGAGG + Intergenic
1138856531 16:60699904-60699926 CATCATCACCAACCATTGCATGG + Intergenic
1141325253 16:83051017-83051039 CCTCTTATCCAGCCAAGACAGGG + Intronic
1141399167 16:83732262-83732284 CCTCCTAACCAGCCCATCTAAGG - Intronic
1143008424 17:3852115-3852137 CCGCATGGCCAGCCCATGCATGG + Intergenic
1143785298 17:9251216-9251238 CCTCCTAGCCAGCCCATGCTGGG + Intronic
1150868074 17:68875669-68875691 CCTCCTAACCACCCACTACATGG - Exonic
1151536772 17:74743367-74743389 ACCCATAAGCAGCCAAGGCAAGG + Intronic
1152163088 17:78681684-78681706 CCTGATATCCAGCCAACCCATGG + Intronic
1154056396 18:11016473-11016495 CCTCATACCCACCCTTTGCAGGG - Intronic
1155343282 18:24834544-24834566 CCTGATAACCACCCAAGACAGGG - Intergenic
1155571838 18:27203064-27203086 CCTAAAAACCAGCCAATTCAGGG + Intergenic
1157980326 18:52372368-52372390 CCTCATAACCAGCCAATGCATGG - Intronic
1158884083 18:61808785-61808807 CCTCTTAACCATGGAATGCAAGG - Exonic
1160018536 18:75162898-75162920 CCTCACAACCAGACAAAGGAAGG + Intergenic
1160033844 18:75283794-75283816 CCTCAAAACCCGCAAATGCAGGG - Intronic
1162838397 19:13337116-13337138 CCTCATAATCTGCCAATGGGAGG + Intronic
1164602022 19:29568585-29568607 CCTCATCACCAGGCAGAGCAGGG - Intergenic
928636940 2:33256375-33256397 CCTCTTAACCAGCTGATACATGG + Intronic
933030842 2:77326773-77326795 CCTTATTTCCAGCCAATGAATGG + Intronic
933220061 2:79678151-79678173 CCTCATAATCAGGCAATTTACGG - Intronic
935087706 2:99864560-99864582 CCTCATGACCAGCCATTCAAGGG + Intronic
939032571 2:137094226-137094248 CCTGAAAACCAGTCAATCCATGG + Intronic
939204034 2:139076869-139076891 CCTCATCATTAGCCAAAGCAAGG + Intergenic
946032757 2:216717979-216718001 CCTCACCACCAGGCCATGCAGGG - Intergenic
1171988159 20:31675302-31675324 ACTCACAGCCTGCCAATGCAGGG - Intronic
1176033458 20:63024988-63025010 CCACATCACCTGCCAATGCCCGG - Intergenic
1176443516 21:6799288-6799310 CCTCACTCCCACCCAATGCAGGG + Intergenic
1177496132 21:21894677-21894699 CCTCATAGCCAGCCTCTGCTAGG - Intergenic
1179128216 21:38611331-38611353 GCTCACAACCCGCCAATGCTGGG + Intronic
1183296799 22:37034505-37034527 CCTCATAAGCACCAAATCCACGG + Intergenic
1183859850 22:40661962-40661984 CCTCACCACCCGCCAATCCATGG - Intergenic
1185265587 22:49900996-49901018 CCTCATGACCAGGCATGGCAGGG - Exonic
951039806 3:17977438-17977460 CCTCATTTCCAACCACTGCATGG + Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
952925691 3:38317771-38317793 CCTCAAAACAATCAAATGCAAGG + Intronic
953721697 3:45361675-45361697 TCTCAAAACCATACAATGCATGG - Intergenic
953787194 3:45920262-45920284 CCTCAAAACCAGCCAGACCAGGG + Exonic
954040665 3:47884915-47884937 CCACATCACCAGCAACTGCAGGG - Intronic
956517864 3:70069686-70069708 CCTCATGACAACCCTATGCAGGG + Intergenic
961839975 3:129701456-129701478 CCCCATAACCAGCCAGTGGGTGG + Intronic
963801736 3:149683159-149683181 CCTCACAACCACCCTATGAAAGG + Intronic
964785535 3:160391891-160391913 CCTAATAACAAACTAATGCAGGG + Intronic
966684378 3:182678186-182678208 CCTCAAAGCCAGCCAGAGCAGGG + Intergenic
967844581 3:194033605-194033627 TCTCAAAGCCAGCCAATGCCTGG - Intergenic
968628846 4:1639959-1639981 GCTCAGAACCAGACAAGGCAAGG - Exonic
971655091 4:29333945-29333967 CCTCAGATCTAGCCAATGAAAGG + Intergenic
971852603 4:32002538-32002560 CCTAAAAACCAGGCAATGCTGGG - Intergenic
975493338 4:75012165-75012187 ACTCAAGACTAGCCAATGCATGG - Intronic
979531067 4:121769647-121769669 CCTCATCTCCAGCACATGCATGG - Intergenic
983416207 4:167458613-167458635 CATCAGAACCAGACAAGGCAGGG - Intergenic
986841618 5:11704246-11704268 CTTCAGAACAATCCAATGCATGG + Intronic
989530565 5:42503194-42503216 CTTCATAACATGCCAATACAAGG - Intronic
990362114 5:55031086-55031108 ACACAAAACCATCCAATGCAGGG + Intronic
990949752 5:61286885-61286907 CCTCATAACCAGCTTACACATGG - Intergenic
992712817 5:79477469-79477491 CCTCATATCCAGCCAACAGAAGG - Intronic
995347378 5:111136026-111136048 CCTCATAAAGACCCAATGCCAGG - Intergenic
997829437 5:137137162-137137184 CCTCATAATCAGCTAAAGCCTGG + Intronic
997870874 5:137504284-137504306 CCCCATAACCATCCCCTGCATGG + Intronic
998540514 5:142977188-142977210 CCTCATAATGAGCAATTGCAAGG + Intronic
999595835 5:153203146-153203168 CCACATGACCACCCAATGCTGGG + Intergenic
1003906476 6:10704755-10704777 CTTCATCTCCAGCCACTGCAAGG - Exonic
1004560948 6:16749975-16749997 GGACATAACAAGCCAATGCACGG - Intronic
1004802368 6:19163885-19163907 CATCATCACCAACCCATGCAAGG + Intergenic
1006521364 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG + Intergenic
1007746550 6:44046796-44046818 CCTCACAGCCAGCCAAAGGAAGG + Intergenic
1020809370 7:12832867-12832889 TCTCAGAACCAGCTAATTCAGGG + Intergenic
1022241636 7:28518039-28518061 CCTCAGCACCAGACAATGAAGGG - Intronic
1026340900 7:69433171-69433193 CCTCAAAAACTACCAATGCAGGG - Intergenic
1038123288 8:24642382-24642404 CTTCAAAACCATTCAATGCAGGG + Intergenic
1041455305 8:58052720-58052742 GCTTATAACCACCCATTGCAAGG - Intronic
1050602976 9:7271551-7271573 CCTGCTAAGCAGCCAAGGCATGG - Intergenic
1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG + Intergenic
1056756953 9:89387668-89387690 CCACACAAGCAGCCAACGCAGGG + Intronic
1057564979 9:96159770-96159792 CCTCATCACCAGCCACTGGATGG + Intergenic
1062733147 9:138120474-138120496 CCCCATAACCAGCCAGAGCAGGG + Intronic
1203525684 Un_GL000213v1:85239-85261 CCTCACTCCCACCCAATGCAGGG - Intergenic
1194232194 X:91338148-91338170 CCTCAAAACCAGGCAATATATGG + Intergenic
1197840918 X:130745678-130745700 CTTCATAAATAGCCATTGCAGGG - Intronic