ID: 1157981317

View in Genome Browser
Species Human (GRCh38)
Location 18:52384594-52384616
Sequence GGGTGAAGACCCTGTGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157981316_1157981317 -6 Left 1157981316 18:52384577-52384599 CCTGGGGTGGCGTGGCGGGGTGA 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1157981317 18:52384594-52384616 GGGTGAAGACCCTGTGTAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 131
1157981315_1157981317 -5 Left 1157981315 18:52384576-52384598 CCCTGGGGTGGCGTGGCGGGGTG 0: 1
1: 0
2: 2
3: 25
4: 249
Right 1157981317 18:52384594-52384616 GGGTGAAGACCCTGTGTAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157981317 Original CRISPR GGGTGAAGACCCTGTGTAGC AGG Intronic
900126749 1:1072155-1072177 GCGTGAGGAGCCTGTGTGGCTGG - Exonic
900252654 1:1679104-1679126 GGTGGCAGAGCCTGTGTAGCGGG - Intronic
900832293 1:4973811-4973833 GGGTCAGCACCCTGTGGAGCAGG - Intergenic
904900073 1:33850091-33850113 GGGAGAAGTGCCAGTGTAGCAGG - Intronic
906460371 1:46031584-46031606 GGGTGAGGCCCCTGGGGAGCTGG + Exonic
907731515 1:57071022-57071044 TGTTGAAGATCCTGTGTACCAGG - Exonic
907946900 1:59143847-59143869 GGGAGAAGACTCTTTGAAGCTGG + Intergenic
920340906 1:205274577-205274599 TGCAGATGACCCTGTGTAGCTGG - Intergenic
924628300 1:245713978-245714000 GAATGAAGAAACTGTGTAGCGGG - Intergenic
1070279269 10:75037054-75037076 GGGAGGAGACCCTCTCTAGCGGG - Intergenic
1070626132 10:78052708-78052730 GGGTGTAAGCCCTGTTTAGCTGG + Intronic
1073303590 10:102485797-102485819 GGGAGAAGACCCTGCCTTGCTGG + Intronic
1075969866 10:126643301-126643323 TGGGGAAGACCCTGTGGAGTGGG - Intronic
1076777010 10:132703484-132703506 GGGTGAAGACACTGTGTGGGGGG - Intronic
1076846804 10:133073196-133073218 TGGTGAGGACCCTGGGCAGCAGG + Intronic
1077371098 11:2182014-2182036 GGGTGTGGACCCTGTGTCCCTGG + Intergenic
1077410879 11:2403383-2403405 GGGCGAGGGCCCTGTGGAGCTGG + Exonic
1078862052 11:15257717-15257739 GGGAGAAGACCATGTGAAGCTGG + Intergenic
1080587747 11:33696873-33696895 TGGTGGAGAAGCTGTGTAGCAGG - Intergenic
1085385951 11:76158495-76158517 TGGAGAAGACCCTGAGAAGCTGG - Intergenic
1087216015 11:95495692-95495714 AGATGAAGACCCTTTGCAGCTGG - Intergenic
1091199035 11:133757563-133757585 TGGTGAAGACCCATTGTAACTGG + Intergenic
1099160309 12:79233165-79233187 GGGTGAGGACACTGTTTAGCTGG - Intronic
1101963387 12:109266081-109266103 GGGTGATGGTCCTGTGCAGCAGG - Intronic
1102616687 12:114160808-114160830 GAGTGCAGACCCCATGTAGCTGG - Intergenic
1103321840 12:120096706-120096728 GGGGCAAGACCCTGTGCAGCGGG + Exonic
1105024272 12:132838162-132838184 GGGTGAAGGCCGTGTGGTGCTGG + Intronic
1107096222 13:36539551-36539573 AGGAGAAGAACCTGTGTAGAGGG - Intergenic
1108676150 13:52739376-52739398 GGGCGAAGGCCCTGTGCTGCGGG - Intronic
1113434268 13:110277534-110277556 GAGTGCAGACCCTGGGAAGCTGG - Intronic
1117040145 14:51761857-51761879 GGGTGAACACCCTCTGTGACCGG - Intergenic
1119066985 14:71538420-71538442 GGATGATGTCCCTGTGTACCAGG - Intronic
1121508219 14:94492618-94492640 GGGTGATGTTCCTGAGTAGCAGG + Intronic
1122035266 14:98944476-98944498 GGATGAAGACCCTTTGAAACGGG - Intergenic
1122963126 14:105108337-105108359 AGGTGCAGACCGTGTGTAACAGG + Intergenic
1123068923 14:105631662-105631684 GGGAGAACACCCTGTGAAGATGG - Intergenic
1130283402 15:82536514-82536536 GGCTGAAGACCCAGGGAAGCAGG + Intergenic
1131991679 15:98099055-98099077 GGGAGAAGCTCCTATGTAGCTGG + Intergenic
1134386074 16:13773868-13773890 GGGTGAAGATCCACTGAAGCTGG + Intergenic
1135587695 16:23683484-23683506 GGGTGAAGGCCTTGTCTAGCTGG - Intronic
1137710454 16:50563312-50563334 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710464 16:50563372-50563394 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710477 16:50563432-50563454 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710502 16:50563552-50563574 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710513 16:50563612-50563634 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710524 16:50563671-50563693 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710535 16:50563731-50563753 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710546 16:50563791-50563813 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710557 16:50563851-50563873 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710568 16:50563911-50563933 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1137710579 16:50563971-50563993 TGGAGAAGACCCTGTGTGTCAGG + Intronic
1138476355 16:57272576-57272598 GGGTGTAGAACCAGTGTTGCCGG - Intronic
1142344984 16:89548132-89548154 GGGTGAAGGCCCTCCTTAGCAGG + Intronic
1142504234 17:352711-352733 GGGTGAAGCCCCTCTGTTCCCGG - Exonic
1146427896 17:32761248-32761270 GGGTGAAGAGAGTGGGTAGCTGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148777896 17:50105802-50105824 GGGTGAAGACACCGTGGAGAGGG + Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1152423581 17:80206993-80207015 GGGTGCAGACACTGTCCAGCTGG - Exonic
1157135533 18:45050688-45050710 GTGTGAACACTCTGTGTGGCCGG + Intronic
1157502334 18:48200339-48200361 TGGTGAAGGGCCTGTGTGGCCGG + Intronic
1157981317 18:52384594-52384616 GGGTGAAGACCCTGTGTAGCAGG + Intronic
1158443616 18:57499697-57499719 GGGTGGAGAACCTTTGTAGCGGG - Intergenic
1159918050 18:74203437-74203459 GGGAGAAGGCCCTGTGAAGATGG - Intergenic
1160261579 18:77299236-77299258 GGGTCAGGACCCTGAGCAGCAGG + Intergenic
925305872 2:2847634-2847656 GTGTGACAACCCTGTGCAGCTGG + Intergenic
927853308 2:26513311-26513333 GGGTGAAGTCCCAGAGAAGCAGG + Intronic
929588094 2:43128479-43128501 GGGTGCAGACCATGTGCATCTGG - Intergenic
929836210 2:45402546-45402568 TGGTTAACAGCCTGTGTAGCAGG - Intronic
938712853 2:133990439-133990461 AGGAGAAGACCCTAGGTAGCAGG + Intergenic
948056434 2:235012293-235012315 GGGTGAAGACGCTGGGTCACTGG - Intronic
1169563800 20:6830454-6830476 GGGTGAAGAGCCTGACTATCAGG - Intergenic
1175019245 20:55826793-55826815 GCGTGAAGACCCTGTGCTGAGGG + Intergenic
1175931905 20:62497538-62497560 GGAGGAACATCCTGTGTAGCAGG + Intergenic
1176300333 21:5096220-5096242 GGGTGAGGGGCCTGTGTGGCAGG - Intergenic
1176300345 21:5096255-5096277 GGGTGAGGGGCCTGTGTAGCAGG - Intergenic
1176300356 21:5096290-5096312 GGGTGAGGGGCCTGTGTGGCAGG - Intergenic
1176300368 21:5096325-5096347 GGGTGAGGGGCCTGTGTAGCAGG - Intergenic
1176300379 21:5096360-5096382 GGGTGAGGGGCCTGTGTGGCAGG - Intergenic
1178862104 21:36298082-36298104 GGGTGTAGCCCCTGTGTATGTGG + Intergenic
1179856666 21:44165621-44165643 GGGTGAGGGGCCTGTGTGGCAGG + Intergenic
1179856678 21:44165656-44165678 GGGTGAGGGGCCTGTGTGGCAGG + Intergenic
1179856690 21:44165691-44165713 GGGTGAGGGGCCTGTGTGGCAGG + Intergenic
1181112548 22:20610492-20610514 GAGTGAAGCCCCTGTGTTGAGGG - Intergenic
1181624277 22:24112781-24112803 AGGTGAAGACCCACTGCAGCTGG - Intronic
1183295916 22:37029498-37029520 GGGGGAAGACCCACTGAAGCTGG + Exonic
1184255067 22:43281855-43281877 GGGACAGGACCCTGTCTAGCAGG - Intronic
1184336498 22:43856262-43856284 TGGTGAAGACCCAATGTGGCTGG + Intronic
949823890 3:8144074-8144096 TGGTGAGGACACTGTCTAGCAGG - Intergenic
952850439 3:37724072-37724094 GGCTTCAGAGCCTGTGTAGCTGG + Intronic
954691156 3:52396364-52396386 GGCGGAAGTCCCTGTGTACCTGG - Exonic
955566742 3:60255545-60255567 GAATGAAGGCCCTGAGTAGCTGG + Intronic
961008301 3:123419648-123419670 CGGGGAAGACTCTGTGTACCCGG + Intronic
969530839 4:7729380-7729402 GGCTGAGGGCCCTGGGTAGCTGG + Intronic
976473230 4:85453897-85453919 AGATGAAGACACTGTGTATCTGG - Intergenic
978327930 4:107579711-107579733 GGATGAAGCCCCTGTGGAGAGGG + Intergenic
982164681 4:152604040-152604062 GAGAGAAGACCCTGTGGAGATGG + Intergenic
982411391 4:155081423-155081445 GGGTGACTACCCTGTATTGCAGG + Intergenic
983581429 4:169313322-169313344 GGGAGAAGACCGTGTGAAGATGG + Intergenic
984925338 4:184801469-184801491 CGGTGAAGAGCCTGTGCATCTGG - Intronic
986248576 5:6033613-6033635 AGATGAAGCCTCTGTGTAGCAGG - Intergenic
991270243 5:64770428-64770450 GTGTGAAGGCCCTGTCTGGCAGG - Intronic
994644374 5:102450756-102450778 GGGTGAAGCACCTGTGTTGCAGG + Intronic
1000223981 5:159240393-159240415 GGGAGAAGACCATGTGAAGATGG - Intergenic
1002345724 5:178546493-178546515 GGGTGCAGACCCTGCAAAGCTGG + Intronic
1002567045 5:180118130-180118152 GGTGGAAGATCCTGTGTACCTGG + Intronic
1002575844 5:180173225-180173247 GAATGCAGGCCCTGTGTAGCTGG - Intronic
1008909009 6:56713194-56713216 GTCTGAAGACCCTGGGCAGCTGG + Intronic
1009192427 6:60645523-60645545 CCGTGAGGATCCTGTGTAGCAGG + Intergenic
1012682952 6:102206100-102206122 GGGTGAAAAGCCTTTGAAGCAGG - Intergenic
1013131955 6:107241764-107241786 TGGTGAAGATCCTGGGTAGTAGG - Intronic
1025833972 7:65078703-65078725 TGGTGAAGGCCCTGTGTGGGAGG + Intergenic
1025903743 7:65768220-65768242 TGGTGAAGGCCCTGTGTGGGAGG + Intergenic
1026501330 7:70945633-70945655 AGATGAAGACTCTGAGTAGCAGG - Intergenic
1029170783 7:98627807-98627829 GGGTTAAGACCCTGAGCAGGGGG - Intronic
1033169962 7:139075253-139075275 GGGTGGAGATTCTGTGTTGCTGG - Intronic
1034868083 7:154657751-154657773 GGGTGGAGAAACTGTGTAGGAGG + Intronic
1036696727 8:10979780-10979802 GAGTGAGGACCCTGTGCTGCGGG + Intronic
1037626869 8:20615756-20615778 AGGTTAAGACCCTGGGTAGGAGG - Intergenic
1038066196 8:23966162-23966184 GGGAGAAGACCGTGTGAAGTTGG + Intergenic
1039551900 8:38449775-38449797 GGGTGAGGGCTCCGTGTAGCTGG - Intronic
1042571774 8:70173096-70173118 TGATCAAGAACCTGTGTAGCAGG - Intronic
1046954016 8:120045051-120045073 AGGTGAAGACCCTCTGTCACAGG - Intronic
1047583963 8:126248827-126248849 GGGTCAAGACCCAGTGCAGCTGG - Intergenic
1049615780 8:143575335-143575357 GAGTGGAGACCCTGTGTGGACGG + Exonic
1053026596 9:34734594-34734616 AGGTGAAGACCCATTGCAGCTGG + Intergenic
1056865107 9:90222035-90222057 GGGTGAGGCCCCTGTGATGCAGG + Intergenic
1059440050 9:114301631-114301653 AGATGAAGACCCTGTGGACCAGG + Intronic
1062041188 9:134405061-134405083 GGGAGGAGACCCTGGATAGCTGG + Intronic
1062338308 9:136082201-136082223 GGGTGAAGACCCTGGGGAGACGG - Intronic
1186660590 X:11664792-11664814 AGGAGAAGACGCTGTGGAGCAGG + Exonic
1196110535 X:111942079-111942101 TGGTGAATTCCCTGTGGAGCAGG - Intronic