ID: 1157982829

View in Genome Browser
Species Human (GRCh38)
Location 18:52401770-52401792
Sequence CATTATGCTCAATTTTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157982829 Original CRISPR CATTATGCTCAATTTTAGGA AGG Intronic
901298687 1:8182149-8182171 GATTATTCTCAATTTCAAGATGG - Intergenic
909394277 1:75152136-75152158 TATTATGCCCAATGCTAGGAAGG - Intronic
910550625 1:88469968-88469990 CACTATGCTACATTTTTGGAAGG + Intergenic
912577704 1:110689365-110689387 CATTATGCTAAATATTTGGTAGG - Intergenic
914901672 1:151714505-151714527 AATTATGCTCAGTGTCAGGAGGG + Intronic
915070875 1:153265299-153265321 CATTAGCCACATTTTTAGGATGG - Intergenic
916060248 1:161093360-161093382 CACTATGCTCAATATTAGGATGG + Intergenic
916379484 1:164193716-164193738 CATTATGCCCCATTTTTTGAGGG - Intergenic
918881940 1:190135665-190135687 CATGATGCTCAAGTTTAGCCTGG - Intronic
919084673 1:192908178-192908200 TTTTATCCTCTATTTTAGGATGG + Intergenic
921240578 1:213177436-213177458 CATATTGCTCAATTTTAGGATGG - Intronic
922809900 1:228409529-228409551 CATGAAGCTCAATTGTGGGAAGG - Intronic
923773568 1:236958920-236958942 GATTGTGATCAATTCTAGGAAGG + Intergenic
1063157295 10:3391496-3391518 CATTTTCCTCATTTTTAAGATGG + Intergenic
1064869073 10:19917396-19917418 TTTGATGCTCAATTTCAGGATGG - Intronic
1069168559 10:65195567-65195589 CATTATTTTGAATTTTAGGAGGG - Intergenic
1075895437 10:125990696-125990718 CATTTGGAGCAATTTTAGGAAGG + Intronic
1079067477 11:17308573-17308595 CATTTTGCTCAATTCTAGAAGGG + Intronic
1079827317 11:25213518-25213540 CATTAGGGTCAAAATTAGGAAGG + Intergenic
1080738797 11:35044328-35044350 CATGCTGCCCAATTTTAGAATGG + Intergenic
1081284228 11:41247654-41247676 CATTATGTTCACTTTTTAGAAGG + Intronic
1081393953 11:42562861-42562883 CATTCTGGTGAATATTAGGAAGG - Intergenic
1083479565 11:62934888-62934910 CATTATCCTCAAGGTGAGGAAGG - Intergenic
1085792125 11:79505195-79505217 CATTATCCTCATTTTGTGGATGG + Intergenic
1094062331 12:26327453-26327475 CATGATGGTCAATTCTGGGAGGG - Intergenic
1097787957 12:63781735-63781757 TATTATGCTCAATTAGAGAATGG + Intronic
1097970609 12:65629321-65629343 TTTTATACTCAATTTTAGAAAGG - Intergenic
1099685437 12:85881491-85881513 AATTATGCTTAATGTTAGAATGG + Intronic
1101202974 12:102456024-102456046 CATTATGCTCAGTGTTAATATGG + Intronic
1101228168 12:102710665-102710687 AATTATGCATAATTTTAGAAAGG + Intergenic
1105537760 13:21285460-21285482 TATTATGCACAATTATATGATGG + Intergenic
1106701315 13:32232271-32232293 CCTTATGCTGAATTCTTGGAGGG + Intronic
1108313818 13:49219812-49219834 CATAATGCTAAATAATAGGAGGG - Intergenic
1111889762 13:94067931-94067953 CATTGTGTTCAATTTTATGTAGG + Intronic
1113027404 13:105956296-105956318 CAATATACTCAATTTTTAGAGGG + Intergenic
1113503272 13:110794747-110794769 CATCATGCTCAGTGTTAGGCTGG + Intergenic
1114881370 14:26790210-26790232 CATGATGCTAACTTTTAAGAGGG + Intergenic
1117068324 14:52032862-52032884 CTTTCTTCTCAATTTTAGGTAGG - Intronic
1120613155 14:86667524-86667546 CATTAATCTTTATTTTAGGATGG - Intergenic
1121296661 14:92831689-92831711 AAGAATGCTCAATTTTAAGATGG - Intronic
1127590550 15:60418103-60418125 CAAAATGATGAATTTTAGGAAGG - Intergenic
1133080923 16:3319559-3319581 CATTCTGTTCAATTTAATGAAGG + Intergenic
1138892811 16:61165681-61165703 CATTATGCTGGCTTGTAGGAGGG - Intergenic
1143086446 17:4419593-4419615 CATTATGCTTACTTTTTGGCGGG - Intergenic
1145314327 17:21720305-21720327 CATTTTGCTGAAATTGAGGATGG - Intergenic
1151191169 17:72399262-72399284 CATTATGCTCATTTTCGTGAGGG + Intergenic
1156929473 18:42624479-42624501 CAATATGCTAATATTTAGGATGG + Intergenic
1156945335 18:42822651-42822673 CAGGATGCACAGTTTTAGGAAGG - Intronic
1157982829 18:52401770-52401792 CATTATGCTCAATTTTAGGAAGG + Intronic
1159279457 18:66267128-66267150 CATTTACCTCAATATTAGGAGGG - Intergenic
1160632296 18:80254989-80255011 CATCTTCCTCAATTTTAGCAAGG + Intergenic
1162054714 19:8055773-8055795 CAATCAGCTCATTTTTAGGAGGG + Intronic
1163156803 19:15444119-15444141 GATTAGCCTCAATTTGAGGATGG + Intronic
1164222852 19:23212081-23212103 CGATAAGTTCAATTTTAGGAGGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165318370 19:35070988-35071010 TATTATCCACAATTTTAGCAGGG - Intergenic
925491933 2:4404850-4404872 CATCATGCGACATTTTAGGATGG - Intergenic
925669587 2:6296908-6296930 CATGATTAACAATTTTAGGATGG + Intergenic
930524026 2:52503657-52503679 CATTTTCCTCATTTTTAGAATGG - Intergenic
932762618 2:74448814-74448836 TATGATGCTCAATTTTTAGAGGG - Intergenic
935534111 2:104273134-104273156 CATGATGCTTAATTTGAGGGAGG - Intergenic
937691631 2:124762605-124762627 CAGTGTGCTCAATTTTAAAATGG - Intronic
939523326 2:143260864-143260886 CATTCTACTCACATTTAGGAAGG + Intronic
939613235 2:144334176-144334198 CAATATTTTCAACTTTAGGATGG + Intergenic
942495003 2:176530918-176530940 GATTATACTAAATATTAGGAAGG + Intergenic
943108822 2:183581111-183581133 CATTAAACTAAATTTTAGAATGG - Intergenic
943683709 2:190794273-190794295 TTTTATGTTCAATTTTTGGAGGG + Intergenic
945534373 2:210995144-210995166 CATTCTGCTTATTTTTAGTATGG + Intergenic
945807657 2:214509865-214509887 CTTTATTATCAATTTAAGGATGG + Intronic
946004360 2:216510533-216510555 GATTATCCATAATTTTAGGAGGG + Intronic
946604702 2:221390588-221390610 CATTTTGCTCCATTTTAGAGTGG - Intergenic
948087839 2:235266104-235266126 CATTTTCCTCATTTGTAGGATGG + Intergenic
948447630 2:238045328-238045350 CAATATGTTTAATTTTAGGTGGG - Intronic
1169596975 20:7211588-7211610 CATTATGCTGTATTTTATGTAGG + Intergenic
1170086167 20:12534845-12534867 CATTATGCATAATGATAGGAGGG + Intergenic
1170481556 20:16770093-16770115 CATTCAGCTTAATTTTAAGAAGG + Intergenic
1170809657 20:19663802-19663824 GATTGGGCTTAATTTTAGGAGGG - Intronic
1172035729 20:32009767-32009789 TATTATGCTCATTTTAAAGACGG + Intergenic
1173466477 20:43286374-43286396 CATTTTGCTCAATTTTCTCAAGG - Intergenic
1173997255 20:47347940-47347962 AATTATGTTCATGTTTAGGAAGG + Intronic
1175059535 20:56229325-56229347 CATTCTGCTGAATTTTAAAAAGG + Intergenic
1178766428 21:35456903-35456925 CATTATGCACAATACTAGTACGG - Intronic
1182821371 22:33219504-33219526 CACTGTGCTGAATATTAGGAAGG - Intronic
949291095 3:2466757-2466779 TATTATGCTCATTTTTAAGAGGG - Intronic
950385356 3:12654783-12654805 CATTATACACAAGTTTAAGAGGG + Intronic
951807520 3:26662825-26662847 CATTATCATTATTTTTAGGAAGG + Intronic
955962502 3:64355287-64355309 TTTTATGCTGAAATTTAGGAGGG - Intronic
956268438 3:67424416-67424438 CATCATCCTACATTTTAGGAGGG - Intronic
956506794 3:69949305-69949327 CATTATGCAATATTTTAAGACGG + Intronic
957313625 3:78549846-78549868 CAATCTGCTTAATTTTAGGAAGG - Intergenic
958502614 3:94934520-94934542 CCTTAAGGTCAATTTTAAGATGG - Intergenic
962186494 3:133265813-133265835 CATAATGTTAAATTTTAGGTTGG - Intronic
962541096 3:136383080-136383102 GATTTTGCTCAAGTTGAGGAAGG + Intronic
964147766 3:153486207-153486229 CATTCTAGGCAATTTTAGGAAGG - Intronic
964185636 3:153939485-153939507 CATGGTGCTCAATGTTAAGAGGG - Intergenic
965120834 3:164554036-164554058 CATTATGCTCGAGATTAGTATGG + Intergenic
966072663 3:175898186-175898208 CATTTTTCTAAATTTTAAGAAGG + Intergenic
966109640 3:176383995-176384017 CAGTCTGCTCAATTTAAGTATGG - Intergenic
966149636 3:176852800-176852822 CATTATGCTGAAATTTAATAAGG - Intergenic
966429877 3:179820270-179820292 CACTAGGCTACATTTTAGGAAGG + Intronic
967373901 3:188779907-188779929 CGTTAGGCTCAAATTTAGGTTGG - Intronic
967641542 3:191870789-191870811 TATTATGCCCAATTTAAGAATGG + Intergenic
968429332 4:546109-546131 AATTATGCTCAATTTTATCATGG - Intergenic
969420856 4:7094962-7094984 CATTATGCTGTGTTTTAAGAGGG - Intergenic
969971044 4:11048495-11048517 CATTATCCTCTATTTTTAGATGG - Intergenic
970434762 4:16022685-16022707 CATTTTTCTCAACATTAGGAAGG + Intronic
971534749 4:27734962-27734984 TAGTATACTCAATATTAGGATGG + Intergenic
972932372 4:44088743-44088765 CATCATGCTACACTTTAGGAAGG + Intergenic
974338258 4:60579727-60579749 CACTATGCTCATTTCAAGGAAGG - Intergenic
975310848 4:72902066-72902088 CATTATTCTGAATTTGAGAATGG - Intergenic
977051917 4:92138885-92138907 AATTATACTCATTTTAAGGATGG + Intergenic
978825836 4:113022322-113022344 AGTAATGCCCAATTTTAGGAAGG - Intronic
981598310 4:146452748-146452770 CACTACGCTCAATATTAAGAGGG + Intronic
981785297 4:148471281-148471303 CATTATGAATTATTTTAGGAAGG - Intergenic
983964659 4:173795091-173795113 CATTATTCTCATTTTAAGTATGG - Intergenic
986856946 5:11880186-11880208 CATTATGCTCATGTGTAAGAGGG + Intronic
987633876 5:20513035-20513057 TATTATGCACAATTTAAGAAAGG - Intronic
987657662 5:20827686-20827708 CATAATTTTCATTTTTAGGACGG + Intergenic
987952548 5:24694061-24694083 CCTAATTCTCAATTTTATGAAGG + Intergenic
988429758 5:31105704-31105726 CATTTTGACCAAGTTTAGGAAGG - Intergenic
988616313 5:32778387-32778409 AATTGTTTTCAATTTTAGGAAGG - Intronic
988765880 5:34376268-34376290 CATAATTTTCATTTTTAGGACGG - Intergenic
991574498 5:68088748-68088770 CATTGTGCTCAACTCTAGGAGGG + Intergenic
992130655 5:73689244-73689266 CTGTTTGCTCATTTTTAGGAAGG + Intronic
992598015 5:78365724-78365746 CACTATGCTCAATTTTAACATGG - Intronic
993137474 5:83988095-83988117 CTTTATGATCAATTTTAGTGTGG - Intronic
994058783 5:95449997-95450019 TATTATGTACAATTTTAGGCTGG + Intronic
994152054 5:96458868-96458890 CGTTATGGGCAATTTTAGGAGGG - Intergenic
994264455 5:97698837-97698859 CATTATTCTCAATTTTTTCATGG - Intergenic
994854642 5:105101387-105101409 CATTAGGCTCATTTTTAATAAGG + Intergenic
995694110 5:114860490-114860512 AATAATTCTTAATTTTAGGATGG - Intergenic
1001881592 5:175249461-175249483 CATTAGGGTCAGTATTAGGAAGG + Intergenic
1004752695 6:18580011-18580033 CATTATGGTGAGTTTTAAGAGGG - Intergenic
1005450613 6:25968097-25968119 CATTTTCCTCAAATTTAGGCAGG - Intronic
1005681258 6:28211076-28211098 CTTCAGGCTCAATTTTAAGAAGG - Intergenic
1008567285 6:52781710-52781732 TAGAATTCTCAATTTTAGGAAGG + Intergenic
1008869260 6:56252730-56252752 CATTGTGGGCAATTTTAGTAGGG - Intronic
1009319641 6:62271291-62271313 CATTGTGCTAGATATTAGGATGG - Intronic
1009863048 6:69360345-69360367 CAATATGCATAATTTTTGGAGGG + Intronic
1010265405 6:73860126-73860148 AATATTACTCAATTTTAGGAAGG - Intergenic
1011084754 6:83526847-83526869 CATTTTGCTCAATTTTTTGGGGG + Intergenic
1011499954 6:87976997-87977019 GACTTTGCTCAATTTTAGAAAGG + Intergenic
1012335593 6:98052442-98052464 CATAATGCACAATTTTAAAAGGG - Intergenic
1014776725 6:125519570-125519592 CTTCATGCTCCATTTTATGAAGG - Intergenic
1016330893 6:142950826-142950848 CATTTTGCACAATTTTATGGGGG - Intergenic
1017507493 6:155082009-155082031 CACTTTGCTCAATCTAAGGATGG + Intronic
1017624229 6:156331945-156331967 CAATATGCTCAATAGTAGAATGG - Intergenic
1021273813 7:18625074-18625096 CATAATTCTCAGTTTTAGAAAGG - Intronic
1022073794 7:26945408-26945430 CATTTTGCTCTATTTAAGAAAGG + Intronic
1023294922 7:38704623-38704645 CATTTTGTTAACTTTTAGGAGGG - Intergenic
1023567192 7:41535048-41535070 CATTATGCTTTATTTTAAGAGGG + Intergenic
1023677795 7:42648931-42648953 CATTACCCTCAATTTAAGGTGGG + Intergenic
1024656037 7:51452018-51452040 CCTTATGCTCCATTTAAGCAGGG - Intergenic
1026489924 7:70854189-70854211 CATTCTCTTCAATTCTAGGAAGG - Intergenic
1028442175 7:90876301-90876323 CATAATCCCCCATTTTAGGATGG + Intronic
1029639080 7:101807108-101807130 CATTACGGTCAAGTTGAGGAAGG - Intergenic
1030988025 7:116264987-116265009 CATTACTCTCAATTTCAGAAAGG - Intergenic
1031873081 7:127108610-127108632 CTTTCTGCTCATTTTTAGAAAGG - Intronic
1032610423 7:133406924-133406946 CCTTATGCTCTTTATTAGGAAGG + Intronic
1032698575 7:134358956-134358978 TATTATGCTGAATTTCAGGTTGG + Intergenic
1034044922 7:147917667-147917689 CAGAATGCTCATTTTTAGGAAGG - Intronic
1034355760 7:150449743-150449765 CATTCTGCTCAGTCTCAGGAGGG + Intergenic
1037234361 8:16699955-16699977 CACTAGGATCAATTTTAGGATGG + Intergenic
1038156410 8:24995113-24995135 CATTATGCTCAACATTAGTGAGG - Intergenic
1038197711 8:25383208-25383230 CATTATACACAATTTTGAGATGG - Intronic
1039492670 8:37959596-37959618 CATTATGGTCTATTATAGTAGGG - Intergenic
1041430910 8:57779751-57779773 CATTATCCTCATTTTTCAGATGG + Intergenic
1042891840 8:73621075-73621097 TATTAAGCTCACTTTTAGTAAGG + Intronic
1047657206 8:126991110-126991132 AATTATGCTCATTTTTTAGATGG - Intergenic
1048057046 8:130877248-130877270 TATCATGCCCAATTTTAGGATGG + Intronic
1048424112 8:134306598-134306620 CAGTATCCTCACTTGTAGGAAGG + Intergenic
1050137854 9:2486869-2486891 CATTGTGCTCAATTAGAAGAGGG + Intergenic
1051129094 9:13839573-13839595 TCTTATGCTCAATTATAGCATGG - Intergenic
1052000602 9:23274911-23274933 CATAATGCTTTACTTTAGGAAGG - Intergenic
1052622000 9:30924525-30924547 AATTATGCTTACATTTAGGAAGG - Intergenic
1058401918 9:104629493-104629515 CCTCATGCTCAATCTCAGGAAGG + Intergenic
1058628111 9:106956849-106956871 CATTATCTTCAATTCTATGAAGG - Intronic
1058982036 9:110179013-110179035 CATTTGGATCACTTTTAGGATGG + Intergenic
1060123295 9:121017232-121017254 CAACATACTCATTTTTAGGAAGG - Intronic
1187114551 X:16335902-16335924 AATTTTGCTCATTTTTAGGAGGG + Intergenic
1187714679 X:22091272-22091294 CATTCTGTCCACTTTTAGGAAGG - Intronic
1188528896 X:31115608-31115630 CAGGATGCTTAATTTTAGTATGG + Intronic
1192235526 X:69293174-69293196 TATAATGCTCATTTTAAGGACGG + Intergenic
1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG + Intronic
1194190485 X:90829800-90829822 CTTTATTCACAATTTTAGAAAGG - Intergenic
1199558854 X:149140983-149141005 CATTGTGCTGAGTTTTAGGAGGG - Intergenic
1200537144 Y:4412224-4412246 CTTTATTCACAATTTTAGAAAGG - Intergenic
1200693973 Y:6340055-6340077 CATTTTCCTCCATCTTAGGATGG - Intergenic
1201041304 Y:9834664-9834686 CATTTTCCTCCATCTTAGGATGG + Intergenic
1202164006 Y:21967987-21968009 CAATAGGATCACTTTTAGGAAGG - Intergenic
1202227350 Y:22618377-22618399 CAATAGGATCACTTTTAGGAAGG + Intergenic
1202315772 Y:23577277-23577299 CAATAGGATCACTTTTAGGAAGG - Intergenic
1202554993 Y:26092797-26092819 CAATAGGATCACTTTTAGGAAGG + Intergenic