ID: 1157983317

View in Genome Browser
Species Human (GRCh38)
Location 18:52407846-52407868
Sequence ACCCATGGCCTACATTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157983313_1157983317 3 Left 1157983313 18:52407820-52407842 CCTCTCCAAATATTTTGTACCAA 0: 1
1: 0
2: 0
3: 19
4: 249
Right 1157983317 18:52407846-52407868 ACCCATGGCCTACATTTCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 144
1157983314_1157983317 -2 Left 1157983314 18:52407825-52407847 CCAAATATTTTGTACCAAAATAC 0: 1
1: 0
2: 6
3: 38
4: 380
Right 1157983317 18:52407846-52407868 ACCCATGGCCTACATTTCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 144
1157983312_1157983317 4 Left 1157983312 18:52407819-52407841 CCCTCTCCAAATATTTTGTACCA 0: 1
1: 0
2: 1
3: 21
4: 282
Right 1157983317 18:52407846-52407868 ACCCATGGCCTACATTTCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157983317 Original CRISPR ACCCATGGCCTACATTTCTG TGG Intronic
900782063 1:4624792-4624814 AGCCATGGCCTTCCTCTCTGTGG - Intergenic
901886003 1:12223512-12223534 ACCCCTGGCCTAGAAATCTGTGG - Intergenic
901942654 1:12675548-12675570 AGCCACTGCCTAGATTTCTGTGG + Intergenic
902084421 1:13848148-13848170 GCCCCTGCCCTACAGTTCTGTGG + Intergenic
906863537 1:49389814-49389836 AGCCATGGCTCACATTTCTTGGG + Intronic
915874193 1:159595052-159595074 ACCCATTCCATACATTTCTTTGG + Intergenic
918931425 1:190860519-190860541 AACCTTGGCCTAGATTTCAGAGG - Intergenic
919777520 1:201203886-201203908 ACCACTGGCCTCCAGTTCTGTGG - Exonic
919982593 1:202651442-202651464 ACCCCAGGCCCACATTTCTAGGG - Intronic
921741872 1:218694712-218694734 CTCCCTGGCCTGCATTTCTGAGG - Intergenic
922171819 1:223161895-223161917 TCCCATGGCCTACATCTGAGAGG - Intergenic
924128034 1:240876180-240876202 TCCCATGGCCTACAAGTCTGTGG + Intronic
1062825658 10:566650-566672 ACCCCTGGCCAAGATTTCTTGGG + Intronic
1071081073 10:81811852-81811874 ACCAATGGACTACATTTATTTGG - Intergenic
1071278060 10:84074770-84074792 TCACATGGCCTTCATTTCTTGGG - Intergenic
1079522403 11:21343561-21343583 ACCCATGGCCTAGACTGTTGTGG - Intronic
1079536975 11:21526619-21526641 AACCATCGCCTAGATTTCAGAGG - Intronic
1081862523 11:46341642-46341664 ACCAATGGACTCCATGTCTGCGG + Intronic
1083254470 11:61487682-61487704 ACCAATGCCCTGCATCTCTGTGG - Intronic
1092561587 12:9619831-9619853 AACCAGGACCTACATTGCTGGGG - Intergenic
1093980946 12:25474913-25474935 GCACATGGCTTCCATTTCTGTGG + Intronic
1096862195 12:54537783-54537805 ACCAATGGTCTAGATTTCTAGGG + Intronic
1096929904 12:55196287-55196309 ACACATGGCTTTCATCTCTGAGG - Intergenic
1098836288 12:75428288-75428310 ACCCATGCCCTAGAAATCTGTGG + Intronic
1102661042 12:114528844-114528866 TCCCTTGTCCTACTTTTCTGTGG + Intergenic
1104086046 12:125474945-125474967 ACCCATGACACCCATTTCTGGGG - Intronic
1105294693 13:19077449-19077471 ACACATCACCTACATATCTGTGG - Intergenic
1107313032 13:39100319-39100341 ACCCAAGGCCTAGTTTTCTTTGG + Intergenic
1109476242 13:62883067-62883089 ACCCATGCCCTAGAGATCTGTGG - Intergenic
1109552283 13:63919036-63919058 ACCCTTGGGTTACATTTTTGGGG - Intergenic
1109761508 13:66835713-66835735 ACCAATGGACTTCATTTCTTTGG + Intronic
1109812661 13:67535341-67535363 ACCCATTGACAATATTTCTGTGG - Intergenic
1111983165 13:95038473-95038495 ACCTCTGGCCAAAATTTCTGAGG + Intronic
1112643769 13:101306395-101306417 CCCATTGGCCCACATTTCTGAGG - Intronic
1117335685 14:54755428-54755450 ACCCTTGGCACACACTTCTGGGG - Intronic
1117609422 14:57466659-57466681 ACCCATGGGTTACATTCCAGTGG - Intergenic
1117750467 14:58917358-58917380 ACTCATGGCCTTCATTTCCATGG + Intergenic
1120706522 14:87751630-87751652 ACCCATGGGCTGGACTTCTGGGG - Intergenic
1126377456 15:48010558-48010580 ACTCTTGGCCTACATTGGTGGGG + Intergenic
1132406774 15:101546530-101546552 ACCCCAGGCCTTCATTTCAGGGG + Intergenic
1132992594 16:2804633-2804655 ACCCATTGCTTAGATTTCTTAGG + Intergenic
1139200804 16:64974845-64974867 ACTCATGCCCTTCATTTCTGTGG - Intronic
1139755697 16:69141609-69141631 ACCCACGTCCTTCAGTTCTGGGG + Intronic
1144086274 17:11811498-11811520 ACCTATGGCCTCCATATCTCTGG - Intronic
1155250153 18:23946455-23946477 ACCCAAAGCCTTCATTTCTAAGG + Intronic
1156817282 18:41326488-41326510 ACACTTGGCTCACATTTCTGTGG + Intergenic
1157812824 18:50709837-50709859 AATCATGGCCAACATTTCTGTGG - Intronic
1157983317 18:52407846-52407868 ACCCATGGCCTACATTTCTGTGG + Intronic
1165248832 19:34513879-34513901 CCCCATGGCCACCATTTCAGAGG + Intergenic
1165256373 19:34579212-34579234 CCCCATGGCCACCATTTCAGAGG + Intergenic
1165687210 19:37832057-37832079 ACCCATGGTTTCCCTTTCTGTGG + Intergenic
1168560041 19:57374704-57374726 GCCCCTGCCCTACATATCTGTGG - Intronic
924993652 2:338002-338024 AACCTTGGCCTAGATTTCAGAGG + Intergenic
925463875 2:4088976-4088998 ACCCATGGGTCCCATTTCTGTGG + Intergenic
929382501 2:41369057-41369079 AACGTTGGCCTACATTTCAGAGG - Intergenic
929961817 2:46502806-46502828 GCCCATGACCAACTTTTCTGGGG - Intronic
930980758 2:57523692-57523714 ACCCTTTGCCTAGATTTCAGAGG + Intergenic
932020794 2:68084328-68084350 ACCCATGGCCTGCTTTTGTATGG - Intronic
932214420 2:69957745-69957767 ACCCATGGTCTAAATTCCAGTGG - Intergenic
936184455 2:110292158-110292180 ACCCACGGTCTACATCTCAGGGG + Intergenic
936234108 2:110728924-110728946 TCACATGGCCTTCCTTTCTGTGG - Intergenic
938019297 2:127893049-127893071 AACCCTGGCATACATTTCTGTGG + Intergenic
939184374 2:138843011-138843033 AGCCATATCCTACATTGCTGGGG + Intergenic
940444677 2:153764153-153764175 TCCCATGCCCTACAAGTCTGTGG + Intergenic
940659276 2:156526667-156526689 AAGCATGGCTTACATTTCTTGGG - Intronic
940917939 2:159278182-159278204 AGCCATTGCTTCCATTTCTGTGG - Intronic
945408566 2:209481519-209481541 ATCCATGGACTCCATTTCTTGGG - Intronic
946420662 2:219562751-219562773 ACACATGGCCTACTTTCCAGGGG - Intronic
947227760 2:227856789-227856811 AACCAAAGACTACATTTCTGAGG - Intergenic
1168851418 20:979603-979625 ACCCAGGGCTTACATATCTTGGG - Intronic
1171379206 20:24720783-24720805 ACCAATGGCATTCAGTTCTGAGG + Intergenic
1173607565 20:44342491-44342513 ACCCATGGCCACCATTTGAGAGG + Intronic
1178286319 21:31328276-31328298 ATCCATGGCTTCCATATCTGTGG + Intronic
1180899681 22:19361303-19361325 ACACATGGCCTCCTTCTCTGCGG + Exonic
1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG + Intronic
1184602631 22:45552594-45552616 ACCCATGGCCGGCGCTTCTGTGG + Intronic
1185249818 22:49795263-49795285 ACCCACGGCCTCCAGGTCTGTGG + Intronic
952428703 3:33201482-33201504 ACCCATTGGCAACATTTCTCTGG + Intronic
958033624 3:88145972-88145994 ACTCATGGTCTACATTTGTAGGG - Intronic
959688835 3:109176911-109176933 GCTCATGGCCTACTTTTCTTTGG - Intergenic
960541968 3:118871431-118871453 AGCCATCGCCTAGATTTCAGAGG + Intergenic
963621090 3:147607715-147607737 ACCCATGTCCTTCAGTTCTAGGG - Intergenic
965809681 3:172578893-172578915 GCCCCTGCCCTAGATTTCTGTGG + Intergenic
970447820 4:16138968-16138990 ACCCATTGACTTCACTTCTGGGG - Intergenic
970763277 4:19517078-19517100 AACCTTGGCCTAGATTTCAGAGG + Intergenic
971986421 4:33830521-33830543 ACTAATGGTCTACATTTATGTGG + Intergenic
974552700 4:63399174-63399196 TACCATGGCCTAAATTTCTTAGG - Intergenic
974624081 4:64399763-64399785 AACCATTGCCTAGATTTCAGCGG + Intronic
977006227 4:91571747-91571769 ACTGATGGCCTACATCTCTGTGG - Intronic
977661220 4:99589128-99589150 ACCCATGGTCAACATTTCACAGG - Intronic
978240542 4:106510632-106510654 GCCCAGGGCCTATGTTTCTGTGG + Intergenic
979066502 4:116142705-116142727 AGCCATTGACTACATTTCTGTGG + Intergenic
984046383 4:174804639-174804661 ATCCATGTCCTAGTTTTCTGTGG - Intronic
988341290 5:29975678-29975700 TCCAATGGCCAAAATTTCTGAGG - Intergenic
988516976 5:31913396-31913418 GCCCATGGTCTGCATTACTGAGG + Intronic
988584438 5:32496512-32496534 GCCCATGGCCAGAATTTCTGTGG - Intergenic
989396475 5:40962542-40962564 TCCCAGGGCCTACAGTTATGAGG - Intronic
989774612 5:45189067-45189089 AAAAATGGCCTACATTTGTGGGG - Intergenic
991523059 5:67522454-67522476 AAGCATAGCCTACATTGCTGTGG - Intergenic
992402200 5:76421668-76421690 ACCCTTGTCCTGCATATCTGAGG - Intronic
992543943 5:77792122-77792144 ACCCATTGCCTTGATTACTGTGG + Intronic
994881161 5:105498317-105498339 ACCCAAGGACTACAATTCTTAGG - Intergenic
999406627 5:151312584-151312606 ACCCATGCCCTATTCTTCTGTGG + Intergenic
999768835 5:154759418-154759440 ATCCATGCCCTTCATGTCTGTGG - Intronic
1001213188 5:169830139-169830161 CTCCATTGCCTACAGTTCTGTGG + Intronic
1001218448 5:169877715-169877737 ACTCATGGACTTTATTTCTGTGG - Intronic
1002291163 5:178201989-178202011 AGCCCTGGCCCTCATTTCTGTGG + Intergenic
1002827394 6:785752-785774 AACTATGGCCTACATTTCAGTGG - Intergenic
1003294098 6:4808540-4808562 ACCCATGGGCTACAGTTCACTGG - Intronic
1008348043 6:50453768-50453790 TCCCATGGACTGCATATCTGAGG - Intergenic
1013799091 6:113919755-113919777 ACCCAGGGCCTACATTATAGAGG + Intergenic
1019630144 7:2044787-2044809 ACTGATGGCCTCCATTTCTTGGG - Intronic
1020046812 7:5046387-5046409 ACCCAAGACCTACCCTTCTGGGG - Exonic
1021180179 7:17497057-17497079 ACCCATGGGTTATATTTCTAAGG + Intergenic
1022599075 7:31739368-31739390 ACCCATGGCGTAGATTTCTAGGG - Intergenic
1022681021 7:32546314-32546336 ACCCATGGTTTACATTTAAGTGG - Intronic
1023303427 7:38798195-38798217 CCCCCTTTCCTACATTTCTGGGG - Intronic
1023785945 7:43707851-43707873 ACACATGCCCACCATTTCTGTGG + Intronic
1024413768 7:49078958-49078980 ACCCTTGGCCTAGATTTCAGAGG - Intergenic
1024667190 7:51558886-51558908 ACCTATGGCCTACAGATCTGTGG + Intergenic
1026222458 7:68412370-68412392 ACCCATGGCCAACAGCACTGTGG + Intergenic
1028947180 7:96593305-96593327 ACACATACCCTACATTTCTTAGG + Intronic
1030365729 7:108643884-108643906 ACCCATGCCCTGCATTTCTTGGG - Intergenic
1030879952 7:114865769-114865791 TCCCAGGGCTTCCATTTCTGTGG + Intergenic
1035049258 7:155989207-155989229 AGACATGGCCTACATGTCTTTGG + Intergenic
1036701652 8:11017209-11017231 ACCCACTGCCTACCTATCTGTGG - Intronic
1039724261 8:40198347-40198369 ACCAATGCGCTACATTCCTGCGG + Intergenic
1042042378 8:64606310-64606332 ACCAAGGACCAACATTTCTGTGG + Intronic
1042384171 8:68153169-68153191 ACCCATGGTGACCATTTCTGGGG + Intronic
1043884143 8:85579323-85579345 CACCATGGCCTCCATCTCTGGGG + Intergenic
1045398202 8:101783320-101783342 ACACAAGGACCACATTTCTGAGG + Intronic
1046370634 8:113301543-113301565 AGCCACTGCCTACATTTTTGTGG - Intronic
1048470491 8:134700295-134700317 TCCCAGAGCCCACATTTCTGAGG + Intronic
1049220436 8:141426422-141426444 AGACAGGGCCCACATTTCTGAGG - Intronic
1051557150 9:18396923-18396945 AACCAAGGCATACATTTCTTAGG - Intergenic
1055813409 9:80177996-80178018 AGCCTTGGCCTAGATTTCAGAGG - Intergenic
1056914353 9:90731972-90731994 GCCCATTCCATACATTTCTGTGG + Intergenic
1056950068 9:91034675-91034697 ACGAGTGGCCTACATGTCTGTGG - Intergenic
1058528711 9:105885354-105885376 AACCATGTCCTTCATTTATGAGG - Intergenic
1059665431 9:116442119-116442141 TCCCTTGGCCTAGATTTCTCAGG - Intronic
1059980483 9:119766218-119766240 GCCCCTGGCCTACTTTTCTGCGG - Intergenic
1189071989 X:37873751-37873773 AACCTTAGTCTACATTTCTGTGG + Intronic
1193287656 X:79731862-79731884 ACCAATGGCCTATTTTGCTGTGG - Intergenic
1193864178 X:86709250-86709272 ACCAATTGACTACATTTGTGTGG - Intronic
1194064554 X:89245679-89245701 ACCCATTGACTATATTTCTATGG + Intergenic
1194168896 X:90557356-90557378 ACCCACTGCCTAGATTTCAGGGG + Intergenic
1194532478 X:95068715-95068737 ACCAATGTCCTACACTGCTGTGG - Intergenic
1194560318 X:95411859-95411881 ACCCTTTGCCTAGATTTCAGAGG + Intergenic
1195329935 X:103788567-103788589 ACCCATGGCCTTCAATTTTAAGG + Intronic
1195502713 X:105620951-105620973 ACCCATGGCCTTGGCTTCTGAGG + Intronic
1195541834 X:106070840-106070862 CCCCAAGGACTACATTGCTGGGG + Intergenic
1195554858 X:106210427-106210449 AACCATTGCCTAGATTTCAGAGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1198443558 X:136688820-136688842 ACACATGGCCTGCAATCCTGTGG + Intronic
1200515139 Y:4135141-4135163 ACCCACTGCCTAGATTTCAGGGG + Intergenic
1200718725 Y:6579757-6579779 ACCCATTGACTATATTTCTATGG + Intergenic
1201073237 Y:10168976-10168998 ACCCATGGGCTGCTTTCCTGAGG + Intergenic