ID: 1157986344

View in Genome Browser
Species Human (GRCh38)
Location 18:52442533-52442555
Sequence CAGGACATACAAAATGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157986338_1157986344 7 Left 1157986338 18:52442503-52442525 CCCATTTTTCAACCAAACATCAT 0: 1
1: 0
2: 2
3: 31
4: 311
Right 1157986344 18:52442533-52442555 CAGGACATACAAAATGATCAAGG 0: 1
1: 0
2: 0
3: 7
4: 232
1157986339_1157986344 6 Left 1157986339 18:52442504-52442526 CCATTTTTCAACCAAACATCATA 0: 1
1: 0
2: 0
3: 38
4: 339
Right 1157986344 18:52442533-52442555 CAGGACATACAAAATGATCAAGG 0: 1
1: 0
2: 0
3: 7
4: 232
1157986342_1157986344 -5 Left 1157986342 18:52442515-52442537 CCAAACATCATATGGCACCAGGA 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1157986344 18:52442533-52442555 CAGGACATACAAAATGATCAAGG 0: 1
1: 0
2: 0
3: 7
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157986344 Original CRISPR CAGGACATACAAAATGATCA AGG Intronic
902477115 1:16694147-16694169 CAGGACATGCAAAAGGTTCCTGG - Intergenic
904230313 1:29064920-29064942 CAGGACAAAGAACATAATCAAGG - Intronic
905155409 1:35974867-35974889 CAGGAAATATAAGATGAGCAAGG - Intronic
905402540 1:37714190-37714212 CAGGACATGCAAAGTGCTTAGGG - Intronic
916120017 1:161521085-161521107 CAGGTTATACCGAATGATCAAGG - Intronic
917045468 1:170854903-170854925 GAGGACATAGAAAATCAGCAAGG + Intergenic
918188489 1:182148704-182148726 CAGCACATACTAGATGCTCAAGG + Intergenic
919247689 1:195009968-195009990 CAGCACAATCAAAATGATAAGGG - Intergenic
921902472 1:220465397-220465419 CACAAAATACAAAATGATAAAGG + Intergenic
923054688 1:230417205-230417227 GAGGAAATACAACATGATCTTGG - Intronic
1063314668 10:4990876-4990898 CAGAAAATACAAAATGAAAATGG - Intronic
1063961296 10:11307482-11307504 CAGAACAGACAAAATGATATAGG - Intronic
1064404768 10:15051935-15051957 CAATGCATACAAAATGAGCATGG + Intronic
1064615352 10:17148362-17148384 AAGTACATACAAAATGAAGAAGG + Exonic
1064892097 10:20187457-20187479 CAAGACATACTAAATGTTTAAGG - Intronic
1067231606 10:44415895-44415917 CAGGACATACACACAGACCAGGG - Intergenic
1068135106 10:52944912-52944934 AAGGAAATATAAAATGAACATGG - Intergenic
1068517244 10:58039797-58039819 TAGGGCATACTAGATGATCAAGG - Intergenic
1069211765 10:65770419-65770441 AAGCACATACAAAATGAGCGTGG - Intergenic
1071590245 10:86865769-86865791 CAGGACATACAGTTTGACCAGGG - Intronic
1073222118 10:101883629-101883651 TAGTACAGACAAAATGGTCATGG + Intronic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1077509213 11:2947170-2947192 CAAGACAAAGAAAATGCTCACGG + Intronic
1077536152 11:3125404-3125426 CAGGACATACAAATGGCTAATGG + Intronic
1080066594 11:28022701-28022723 CATGTCAAACCAAATGATCAAGG + Intronic
1082225379 11:49700096-49700118 CAGCACATACATCATGCTCAAGG - Intergenic
1086039164 11:82454184-82454206 AGGAACATAGAAAATGATCAAGG - Intergenic
1086623712 11:88919609-88919631 CAGCACATACATCATGCTCAAGG + Intronic
1087761399 11:102107726-102107748 CTGGACATTGAAAATGATCCAGG + Intergenic
1087825960 11:102765037-102765059 CAGGAAATTCTAAATGATTAGGG - Intergenic
1088708879 11:112488353-112488375 CAGACAATACAAAATTATCATGG + Intergenic
1089165437 11:116472406-116472428 CAGGAACAACAAAATGCTCAAGG - Intergenic
1089193454 11:116674576-116674598 CAGCACATAGAAAATTCTCAAGG + Intergenic
1091576280 12:1739178-1739200 CTGAACATAAAAAATGATGAAGG + Intronic
1091685319 12:2557413-2557435 CAGAACCTACAAAAGGATCCAGG + Intronic
1093784577 12:23177313-23177335 CAGGAGATACAGAATCAGCAGGG - Intergenic
1094226888 12:28056023-28056045 TAGGACATTGAAAATGCTCATGG - Intergenic
1094421505 12:30276532-30276554 CAGGAAAAACATAATGCTCAAGG - Intergenic
1095539615 12:43293836-43293858 CAGAACATCAGAAATGATCATGG + Intergenic
1098393098 12:69990302-69990324 CAGGACCTGGAAAATGAGCAAGG - Intergenic
1098828773 12:75332891-75332913 CAGGGGATATAGAATGATCAGGG + Intronic
1102848948 12:116220206-116220228 CAAAACATACCAAATAATCATGG + Intronic
1104327756 12:127816206-127816228 CTGGAACTACAAAATGCTCAAGG - Intergenic
1105796663 13:23860918-23860940 CAGGACCTAACAAATGATTATGG + Intronic
1106381750 13:29246036-29246058 CCGGTCATAGAAAATGATCCTGG + Intronic
1107909681 13:45093662-45093684 CAACACATACAAAATGGTAAGGG + Intergenic
1108084937 13:46777556-46777578 CTGGACATACTAATTGATCAAGG - Exonic
1109938022 13:69319050-69319072 CAAGACAAAGAAAATGAACAAGG - Intergenic
1110970029 13:81750326-81750348 CACGCAATACAAAATGATAAAGG + Intergenic
1112733985 13:102397335-102397357 TAGGAAATAGAAAGTGATCATGG + Intronic
1114568727 14:23650833-23650855 CAGGGCACACAAAATAGTCATGG - Intergenic
1115699846 14:35941890-35941912 CACGACATACTAAATGAACTTGG + Intergenic
1116061316 14:39928035-39928057 CAGGACACATTAAATGATAAGGG + Intergenic
1117669056 14:58087413-58087435 CTGGACATACTAAATTCTCATGG + Intronic
1118451111 14:65903167-65903189 CAGAAAATACAAAATGAACTTGG + Intergenic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1121356078 14:93216205-93216227 CAGAAAATACAAAATTAGCAGGG - Intronic
1124514243 15:30352719-30352741 CAGGACAGATAAAATGTCCATGG - Intergenic
1124728676 15:32178045-32178067 CAGGACAGATAAAATGTCCATGG + Intergenic
1125073213 15:35581008-35581030 CAGGACATAAAATCTGAGCAGGG + Intergenic
1125078960 15:35654319-35654341 GTGGACATAAAATATGATCAGGG + Intergenic
1131596023 15:93799033-93799055 CAGGCCATACAAAATAATAAAGG + Intergenic
1131858403 15:96624866-96624888 CAGGGCATGCAAAAGGAACATGG + Intergenic
1131909206 15:97177900-97177922 CAGAACACACATAATGATCGCGG - Intergenic
1134059940 16:11193189-11193211 CAGGGAAGACAAAATGATGATGG - Intergenic
1136958521 16:34815590-34815612 CAGGAAATAGAAAATGAAGAAGG - Intergenic
1137518279 16:49169522-49169544 GAGGACATCGAAAATGATCAAGG + Intergenic
1139098763 16:63738959-63738981 CAGGACATGGAAAATTGTCAGGG + Intergenic
1140959825 16:79901027-79901049 CAAGAAATACAAAAAGAGCAAGG - Intergenic
1143274644 17:5701109-5701131 CAGGACATAGAGAATGGTCTTGG + Intergenic
1146431652 17:32801846-32801868 CAGGAAATACAAGATGAACCTGG + Intronic
1146993139 17:37294146-37294168 TAGCCCATACAAAATGATCTTGG - Intronic
1148757356 17:49980603-49980625 CAGGACAGAGAAGATAATCATGG - Intergenic
1149267487 17:54943063-54943085 CAGGACAAAGAAAATTATGAGGG - Intronic
1152339175 17:79714985-79715007 CAGGACCTGCCAAAAGATCAGGG - Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1155872520 18:31044925-31044947 CAGCACAGTCAAAATAATCAGGG - Intergenic
1155889124 18:31244569-31244591 CAGCACACACAAAAAGACCAGGG - Intergenic
1157043917 18:44072980-44073002 TAGGACATGGAAAATTATCAGGG - Intergenic
1157261853 18:46182402-46182424 AAGGAGATAGAAAATGACCAGGG + Intronic
1157986344 18:52442533-52442555 CAGGACATACAAAATGATCAAGG + Intronic
1158692362 18:59671979-59672001 CAGGACAGAAGAAAGGATCAAGG + Intronic
1158758771 18:60358811-60358833 CAGTACATAGTAAATGATAATGG + Intergenic
1160025685 18:75213572-75213594 AAGGACAAACAAAATGCTGAGGG + Intronic
1160555899 18:79724969-79724991 CAGGAAATCCAACTTGATCAAGG - Intronic
1166597440 19:44062442-44062464 CAGGACATAAAAAATATTTAGGG - Intronic
1167165051 19:47793501-47793523 CATGACATCAAAAATCATCAGGG - Intergenic
1168357801 19:55713207-55713229 CATGATATACAAAATAGTCAGGG - Intronic
1168548948 19:57277622-57277644 CAGGGAAGGCAAAATGATCAGGG + Intergenic
1168589977 19:57625172-57625194 TATGAAATTCAAAATGATCAAGG - Intergenic
1202711131 1_KI270714v1_random:19973-19995 CAGGACATGCAAAAGGTTCCTGG - Intergenic
927433453 2:23046913-23046935 CAGAACGTGCAAAATAATCAAGG - Intergenic
929035315 2:37685544-37685566 CAGGAGCTACAAAATGCTCTAGG - Intronic
930446316 2:51477490-51477512 CAGAACATGGAAAATAATCAAGG - Intergenic
930670038 2:54139146-54139168 CAGGACATACAAATTGGAGAGGG - Intronic
930890528 2:56381055-56381077 CAGCACATAAAAAATGCCCAGGG - Intronic
931311476 2:61085204-61085226 CAGGACATACAAAAAAAGTATGG - Intronic
931490957 2:62746470-62746492 CAGGACATAGAAAGTGGTGAAGG + Intronic
931914848 2:66942965-66942987 CATCACATAGAAAATGATCCTGG - Intergenic
932369106 2:71173047-71173069 AAAGACATACAGACTGATCATGG - Intergenic
932536141 2:72597816-72597838 CAGAACAAATAAAATTATCAGGG + Intronic
932924933 2:75962199-75962221 CAGAACAAAGAAAATTATCAGGG + Intergenic
933436313 2:82255011-82255033 AAGGGCATACATAATGATAAAGG - Intergenic
933857137 2:86426787-86426809 CAGGGAATACAAAAAGATTAGGG + Intergenic
936267735 2:111023271-111023293 AAGGACATACAAATGGATCTGGG + Intronic
936379723 2:111973666-111973688 CAGAACAGACAAAATGATATCGG - Intronic
936614137 2:114031728-114031750 CCGGACATTTAAAATGAACACGG - Intergenic
937582500 2:123504169-123504191 GAGAACATACATAATTATCAAGG + Intergenic
940586676 2:155660546-155660568 CAGAAAATGCAAAATGTTCATGG - Intergenic
944941871 2:204637179-204637201 AAGGACATGCAAAATGCTCCTGG - Intronic
946069426 2:217018913-217018935 AAGGACTTACAGGATGATCAGGG + Intergenic
946124251 2:217546782-217546804 AAGAACATAAAAAATCATCAAGG + Intronic
948483284 2:238263877-238263899 CAGGATATACAGAATGTTCCTGG + Intronic
948858337 2:240740936-240740958 CAGCACTTACAAAGTGATCAAGG - Intronic
1169603989 20:7294596-7294618 AAGGAGATACAAACTGAGCAGGG - Intergenic
1170203256 20:13768046-13768068 CAGAACCAACATAATGATCAGGG - Intronic
1171213337 20:23333983-23334005 CATCACCTGCAAAATGATCAAGG + Intergenic
1173775868 20:45705915-45705937 CTGTACTTACAAAATGATCTAGG - Exonic
1173829923 20:46076226-46076248 GGGGGCATACAAAATGATTAGGG + Intronic
1173996549 20:47342920-47342942 AAAGACATACAAAATGAGCCTGG + Intronic
1178050036 21:28737043-28737065 CAGTAAATACAAAATGATTGGGG + Intergenic
1180254607 21:46616580-46616602 AAGGGCATACAAAATGCTAAAGG - Intergenic
1181794870 22:25299838-25299860 CAGGATAAACAAACTAATCAAGG - Intergenic
1181835437 22:25603487-25603509 CAGGATAAACAAACTAATCAAGG - Intronic
1181884705 22:26011103-26011125 CAGGAATTCAAAAATGATCATGG + Intronic
1184237215 22:43189322-43189344 CAGGATTTACAAAGTGAGCATGG - Intergenic
949793363 3:7818131-7818153 CAGGACTTAGAAAATCATAATGG - Intergenic
950519345 3:13487323-13487345 CAGCACACACAGAATGACCAGGG - Intronic
951261147 3:20510843-20510865 CAGAAAATAAAAAAAGATCAGGG - Intergenic
951990780 3:28674162-28674184 GAAGACCTAGAAAATGATCATGG - Intergenic
954803323 3:53200248-53200270 GATGACATGCAAAATGTTCATGG - Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955240959 3:57177746-57177768 CAGGAAATACAACATGACCCTGG - Intergenic
956643117 3:71432988-71433010 AAGCAGGTACAAAATGATCAGGG - Intronic
963744536 3:149113078-149113100 CAGGCAAAACAAAATGATCTTGG - Intergenic
965109706 3:164405004-164405026 AAGGACCTGCAATATGATCAGGG - Intergenic
965293295 3:166911446-166911468 GAAGAAATACAAAATGTTCATGG - Intergenic
966038283 3:175447420-175447442 TAGGAGATTAAAAATGATCATGG - Intronic
967197612 3:187042385-187042407 GAGGACATATAAAGTGTTCATGG + Intronic
967450199 3:189614628-189614650 CAAGAGATACAAAATAATGAAGG - Intergenic
967581205 3:191157111-191157133 GAGAACTTACAAAAAGATCATGG + Intergenic
968346016 3:198009367-198009389 GAGGAATTACAAAATGATAAAGG - Intronic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
973116469 4:46466134-46466156 CTGAAAATACAAAATTATCAGGG - Intronic
973202674 4:47521875-47521897 CAGGACATACCAAATGCACAAGG - Intronic
973276649 4:48317417-48317439 GTGGACAAACAAAATGATAAAGG - Intergenic
973692382 4:53450758-53450780 CAGGAAATTCACCATGATCATGG - Intronic
975067338 4:70083858-70083880 TATCACATACAATATGATCATGG - Intergenic
977564659 4:98568760-98568782 CAAGACATGCAAAATCATCCTGG + Intronic
977954000 4:103006127-103006149 CAAGCAATACAAAAAGATCAAGG + Intronic
978476332 4:109135531-109135553 CAGCACATTCAGAAGGATCAAGG - Intronic
980843553 4:138296471-138296493 CAAGAGACACAAAATAATCAAGG - Intergenic
980894026 4:138844402-138844424 CAGGGCATAAAAGATTATCAAGG + Intergenic
981764548 4:148233519-148233541 CAAAACATACAAAATTATCCAGG - Intronic
981932415 4:150205298-150205320 AAGGACATACAACATTCTCAGGG - Intronic
982724550 4:158891634-158891656 CAGTACTTACAAAATCAGCAGGG - Exonic
983365144 4:166776859-166776881 AAGGGCATAGAAAATTATCAAGG + Intronic
984483261 4:180333266-180333288 CAGGACATAGAGAATGAGAATGG + Intergenic
984652393 4:182284571-182284593 TAGGGTATACAAAATAATCAGGG - Intronic
986101284 5:4614015-4614037 CAGGACATCCATACAGATCAGGG + Intergenic
986726725 5:10603567-10603589 CAGAAAATACAAAATGTTTAAGG - Intronic
988506090 5:31824574-31824596 CACGAACTACAAAAGGATCAAGG - Intronic
989457231 5:41658263-41658285 CAGGTCACACAAAGTCATCAAGG + Intergenic
991734809 5:69621952-69621974 CCTGAAATACAAGATGATCAGGG + Intergenic
991780169 5:70124766-70124788 CCTGAAATACAAGATGATCAGGG - Intergenic
991811243 5:70477087-70477109 CCTGAAATACAAGATGATCAGGG + Intergenic
991859456 5:71000195-71000217 CCTGAAATACAAGATGATCAGGG - Intronic
991872616 5:71125089-71125111 CCTGAAATACAAGATGATCAGGG - Intergenic
992028527 5:72696398-72696420 AAGGACACACAAAATTATTAGGG + Intergenic
993611678 5:90061938-90061960 CATGATATAAAAAATGTTCAGGG - Intergenic
994533371 5:100994873-100994895 CAGAACATACAAAATAATTTGGG - Intergenic
999794192 5:154972874-154972896 CAGAAAATATTAAATGATCATGG - Intergenic
1001015032 5:168133026-168133048 CAGGATATACAAAATGTATATGG - Intronic
1002892141 6:1343750-1343772 CAGGACAAGGAAAATTATCAGGG + Intergenic
1005558422 6:27011705-27011727 GATGACATAAAAAATGATAAAGG + Intergenic
1006237133 6:32643358-32643380 CTGGACATGAAAAATGATCTGGG - Exonic
1006777349 6:36605844-36605866 CAGGACATTCCAAATGATTAGGG - Intergenic
1007259487 6:40553615-40553637 CAGCACATAGCAAATGCTCAGGG + Intronic
1008601128 6:53096485-53096507 CAGGACCTTCCAAATGAGCAGGG - Intronic
1010849379 6:80752899-80752921 TAGGAAATACAAAATGAGAAGGG - Intergenic
1011198061 6:84802894-84802916 CAGGACATACAAAAGCATTTTGG - Intergenic
1011948025 6:92931578-92931600 CAAGACATTAAAAATGGTCATGG + Intergenic
1012560483 6:100574374-100574396 CAGGACATTCAAAAGGTTCCCGG + Intronic
1013682406 6:112539765-112539787 AATGACATACAAAATGAATATGG - Intergenic
1014340413 6:120198491-120198513 CAGGACACACATACAGATCAGGG - Intergenic
1014500594 6:122184234-122184256 CAGGACAAATAAAAAGATCCTGG - Intergenic
1015503434 6:133956562-133956584 AGGGACATACAATATGATGATGG - Intronic
1016561667 6:145401766-145401788 CAGGGCTTAAAGAATGATCATGG + Intergenic
1016578165 6:145595298-145595320 CAGAACAATGAAAATGATCATGG + Intronic
1021037871 7:15823396-15823418 CAGGACAGATAAAAAGAGCAAGG - Intergenic
1021465189 7:20934852-20934874 CAGCACAAACATAATGGTCAAGG + Intergenic
1023311754 7:38894711-38894733 CAGGTCATACAAAAAGCACAAGG + Intronic
1023478166 7:40603705-40603727 CAGGACATACCAAATAAGAAGGG - Intronic
1026614873 7:71892786-71892808 CAGAACATACAAAATGTGAAAGG - Intronic
1028238998 7:88396896-88396918 CAGGACATACAAAGTTCTGATGG - Intergenic
1028645419 7:93090798-93090820 CAGCACATACAAGATTTTCAAGG - Intergenic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030862193 7:114647529-114647551 CAGAAAATACAAAATGATGAAGG + Intronic
1038458445 8:27694681-27694703 CTGTACATACCAAATTATCATGG - Intergenic
1039870938 8:41544531-41544553 CATGACATACTAAATGAACTTGG - Exonic
1040872425 8:52114271-52114293 CAAAACATACAAAAAGAACAGGG - Intronic
1042883772 8:73524424-73524446 ACGGATATGCAAAATGATCAGGG - Intronic
1043285225 8:78519631-78519653 GAGGACTTATAAAATGAACAGGG - Intronic
1044035767 8:87301779-87301801 GAGGAAATAAAAAATGATAAAGG + Intronic
1048538389 8:135319093-135319115 CAGGAGATTCCAAATTATCAGGG - Intergenic
1048685021 8:136895086-136895108 CAGGATATAGAAACTGATAAAGG - Intergenic
1050109969 9:2204719-2204741 CAGAACAAAGAAAATTATCAGGG + Intergenic
1050785204 9:9392465-9392487 CAGTAGATACAAAATTACCACGG + Intronic
1051424832 9:16922563-16922585 GAAGAAATATAAAATGATCAAGG + Intergenic
1051876512 9:21800043-21800065 CAGGACAGACATACTGGTCAGGG + Intergenic
1051918154 9:22231698-22231720 AAGGACATACATAATGGTAAAGG + Intergenic
1057344185 9:94233473-94233495 TATGAGATACAAAAGGATCAGGG - Intergenic
1057517614 9:95735394-95735416 CAGGACATGCAAAGTGAACCTGG - Intergenic
1058606865 9:106732245-106732267 GAGGACTTACAAAGTGCTCAGGG - Intergenic
1059063535 9:111058680-111058702 CAGAACATTCAATGTGATCATGG + Intergenic
1059651530 9:116320192-116320214 CTGGCCAGACCAAATGATCATGG - Intronic
1061320569 9:129825799-129825821 CAGGAAATACAAGATGAGCCCGG - Intergenic
1185631458 X:1518634-1518656 GGGGACAAACAAGATGATCAGGG - Intronic
1186120592 X:6357160-6357182 AAGAACATACAAAAAGTTCATGG + Intergenic
1186840785 X:13483076-13483098 CAGGACATGGAAAATGAGAAGGG + Intergenic
1187374708 X:18741592-18741614 CAAGAAATAAAACATGATCAGGG + Intronic
1188235474 X:27725297-27725319 AAGGACATGCAAAATGCCCAAGG + Intronic
1188805695 X:34586284-34586306 CAGGAGATAGGAAATGATGAGGG - Intergenic
1189377949 X:40480484-40480506 TAGGAGATAGAAACTGATCAGGG + Intergenic
1189637897 X:43031802-43031824 CAGGAATTACAAAAGGTTCAGGG - Intergenic
1191158542 X:57302110-57302132 AATGACATAGAAAATGGTCACGG + Intronic
1192093559 X:68186290-68186312 CAGGACATAAGAGATGCTCAGGG + Intronic
1192729545 X:73789281-73789303 AAGGACATACATAATGGTAAAGG - Intergenic
1193399542 X:81026816-81026838 CATGATAAACAAAATGATCGGGG + Intergenic
1194030805 X:88811421-88811443 CAGCACATACAAAATGTTGTGGG + Intergenic
1194125416 X:90010499-90010521 CAAAACATTTAAAATGATCAAGG - Intergenic
1194260483 X:91688123-91688145 AAGAGCATACAAAATGATAAAGG + Intergenic
1195709592 X:107763462-107763484 AAGGACAAATAAACTGATCAAGG - Intronic
1195733423 X:107988933-107988955 AAGGAAATAAAAAATGATAAAGG - Intergenic
1197666516 X:129229962-129229984 CAAAAAATACAAAATTATCAGGG + Intergenic
1199039935 X:143101179-143101201 CAGGACAGACATAAAGTTCAGGG - Intergenic
1199208719 X:145180692-145180714 CAAGACATAGAACAAGATCATGG + Intergenic
1202084336 Y:21120047-21120069 CTGTACATACAAAATGAGAATGG + Intergenic
1202367548 Y:24177515-24177537 CAGGACTTAAAAAAACATCATGG + Intergenic
1202503235 Y:25492608-25492630 CAGGACTTAAAAAAACATCATGG - Intergenic